Incidental Mutation 'R1192:Exosc9'
ID100862
Institutional Source Beutler Lab
Gene Symbol Exosc9
Ensembl Gene ENSMUSG00000027714
Gene Nameexosome component 9
SynonymsRRP45, PM/Scl-75, p6, p5, Pmscl1
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location36552606-36565727 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 36552755 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029269] [ENSMUST00000136890] [ENSMUST00000155866]
Predicted Effect probably benign
Transcript: ENSMUST00000029269
SMART Domains Protein: ENSMUSP00000029269
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 1.7e-25 PFAM
Pfam:RNase_PH_C 189 255 3.4e-14 PFAM
low complexity region 308 324 N/A INTRINSIC
low complexity region 348 366 N/A INTRINSIC
low complexity region 396 406 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133854
Predicted Effect probably benign
Transcript: ENSMUST00000136890
SMART Domains Protein: ENSMUSP00000121047
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 1 79 3e-16 PFAM
Pfam:RNase_PH_C 105 147 3.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149041
Predicted Effect probably benign
Transcript: ENSMUST00000155866
SMART Domains Protein: ENSMUSP00000122189
Gene: ENSMUSG00000027714

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 2.6e-25 PFAM
Pfam:RNase_PH_C 189 241 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156100
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the human exosome, a exoribonuclease complex which processes and degrades RNA in the nucleus and cytoplasm. This component may play a role in mRNA degradation and the polymyositis/scleroderma autoantigen complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Exosc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Exosc9 APN 3 36553139 unclassified probably benign
IGL00949:Exosc9 APN 3 36563266 unclassified probably benign
IGL01718:Exosc9 APN 3 36553929 unclassified probably benign
IGL02072:Exosc9 APN 3 36554672 missense probably damaging 1.00
IGL02217:Exosc9 APN 3 36552744 missense probably damaging 0.99
IGL02439:Exosc9 APN 3 36553031 unclassified probably benign
IGL02871:Exosc9 APN 3 36565281 missense probably benign 0.00
IGL02994:Exosc9 APN 3 36553138 unclassified probably benign
IGL03144:Exosc9 APN 3 36554135 missense probably damaging 1.00
R0909:Exosc9 UTSW 3 36554704 missense probably damaging 1.00
R2516:Exosc9 UTSW 3 36563162 missense probably benign
R4288:Exosc9 UTSW 3 36563216 missense probably benign
R4770:Exosc9 UTSW 3 36553835 missense probably damaging 0.98
R5875:Exosc9 UTSW 3 36561193 critical splice donor site probably null
R5928:Exosc9 UTSW 3 36555625 intron probably benign
R6120:Exosc9 UTSW 3 36554672 missense probably damaging 1.00
R7077:Exosc9 UTSW 3 36553056 missense probably damaging 1.00
R7340:Exosc9 UTSW 3 36561148 missense possibly damaging 0.86
R7443:Exosc9 UTSW 3 36553841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAATCTCCACTGCGATGCC -3'
(R):5'- CAACGTCCCTGCCACTGAATACTG -3'

Sequencing Primer
(F):5'- GGAAATCTTCGTTGATTTGCTACAC -3'
(R):5'- CACTGAATACTGCTGGCTTAAGG -3'
Posted On2014-01-15