Incidental Mutation 'R1192:Pcgf3'
ID100874
Institutional Source Beutler Lab
Gene Symbol Pcgf3
Ensembl Gene ENSMUSG00000033623
Gene Namepolycomb group ring finger 3
SynonymsRNF3A, Rnf3, D630042K08Rik, 2310035N15Rik, DONG1
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108461232-108506976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108486188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000108216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046975] [ENSMUST00000112597] [ENSMUST00000138264]
Predicted Effect probably benign
Transcript: ENSMUST00000046975
AA Change: V104A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041790
Gene: ENSMUSG00000033623
AA Change: V104A

DomainStartEndE-ValueType
RING 17 55 2.87e-5 SMART
Pfam:RAWUL 158 235 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112597
AA Change: V104A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108216
Gene: ENSMUSG00000033623
AA Change: V104A

DomainStartEndE-ValueType
RING 17 55 2.87e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138264
SMART Domains Protein: ENSMUSP00000142465
Gene: ENSMUSG00000033623

DomainStartEndE-ValueType
PDB:2CKL|A 3 37 7e-9 PDB
SCOP:d1jm7b_ 5 37 4e-3 SMART
Blast:RING 17 37 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151897
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C3HC4 type RING finger, which is a motif known to be involved in protein-protein interactions. The specific function of this protein has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit limb defects and spleen agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Pcgf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Pcgf3 APN 5 108486179 missense probably benign 0.18
R0501:Pcgf3 UTSW 5 108475112 missense probably damaging 1.00
R4947:Pcgf3 UTSW 5 108487961 missense probably benign 0.03
R6560:Pcgf3 UTSW 5 108473902 missense probably damaging 1.00
R8087:Pcgf3 UTSW 5 108486236 missense probably benign
R8152:Pcgf3 UTSW 5 108487857 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGAGCCTGTCTTGTTGCACC -3'
(R):5'- GGTCCATTAACCAGGGCTGATGAAG -3'

Sequencing Primer
(F):5'- GGTCATTAAGGTTCCCATCCTG -3'
(R):5'- CTGATGAAGAACCTTTTCAGCAAC -3'
Posted On2014-01-15