Incidental Mutation 'R1192:Anks4b'
ID100884
Institutional Source Beutler Lab
Gene Symbol Anks4b
Ensembl Gene ENSMUSG00000030909
Gene Nameankyrin repeat and sterile alpha motif domain containing 4B
Synonyms2010013E14Rik, Harp
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120173858-120185586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120174066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 50 (I50L)
Ref Sequence ENSEMBL: ENSMUSP00000033201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033201]
Predicted Effect probably benign
Transcript: ENSMUST00000033201
AA Change: I50L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033201
Gene: ENSMUSG00000030909
AA Change: I50L

DomainStartEndE-ValueType
ANK 31 60 1.03e-2 SMART
ANK 64 93 6.3e-7 SMART
ANK 97 126 3.69e2 SMART
coiled coil region 131 165 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
coiled coil region 303 335 N/A INTRINSIC
SAM 346 411 6.52e-8 SMART
Meta Mutation Damage Score 0.0793 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Anks4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Anks4b APN 7 120173925 missense possibly damaging 0.69
IGL01830:Anks4b APN 7 120173996 missense probably damaging 1.00
IGL02490:Anks4b APN 7 120174018 missense probably damaging 1.00
IGL02820:Anks4b APN 7 120182691 unclassified probably benign
IGL03074:Anks4b APN 7 120181917 missense probably damaging 1.00
R0383:Anks4b UTSW 7 120182874 missense probably damaging 1.00
R0747:Anks4b UTSW 7 120182163 missense probably damaging 0.96
R1125:Anks4b UTSW 7 120182357 missense possibly damaging 0.66
R3079:Anks4b UTSW 7 120181923 missense probably damaging 1.00
R3080:Anks4b UTSW 7 120181923 missense probably damaging 1.00
R5542:Anks4b UTSW 7 120182423 nonsense probably null
R5954:Anks4b UTSW 7 120182173 missense possibly damaging 0.92
R6001:Anks4b UTSW 7 120182718 missense probably benign 0.30
R6920:Anks4b UTSW 7 120183008 missense probably damaging 1.00
Z1088:Anks4b UTSW 7 120182519 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCTACCCGCTATCACCAAGCAG -3'
(R):5'- ATTCAGCTTACACCAAGGCCGAG -3'

Sequencing Primer
(F):5'- TATCACCAAGCAGCGAGTG -3'
(R):5'- CTGCCTGAGTGACTCCTAAATGG -3'
Posted On2014-01-15