Incidental Mutation 'R1192:Nkiras2'
ID100901
Institutional Source Beutler Lab
Gene Symbol Nkiras2
Ensembl Gene ENSMUSG00000017837
Gene NameNFKB inhibitor interacting Ras-like protein 2
SynonymsKBRAS2, 4930527H08Rik, 2410003M04Rik
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1192 (G1)
Quality Score129
Status Validated
Chromosome11
Chromosomal Location100619244-100627607 bp(+) (GRCm38)
Type of Mutationunclassified (4740 bp from exon)
DNA Base Change (assembly) T to C at 100625980 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017981] [ENSMUST00000051947] [ENSMUST00000103119] [ENSMUST00000107376] [ENSMUST00000142993]
Predicted Effect probably benign
Transcript: ENSMUST00000017981
SMART Domains Protein: ENSMUSP00000017981
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 168 4.3e-9 PFAM
Pfam:Roc 6 124 2.2e-13 PFAM
Pfam:MMR_HSR1 6 165 3.1e-6 PFAM
Pfam:Ras 6 170 2.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051947
SMART Domains Protein: ENSMUSP00000059559
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 168 5.6e-9 PFAM
Pfam:Miro 6 123 2.2e-21 PFAM
Pfam:Ras 6 170 4.5e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103119
SMART Domains Protein: ENSMUSP00000099408
Gene: ENSMUSG00000014198

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
ZnF_U1 72 108 4.36e-2 SMART
ZnF_C2H2 77 99 1.51e0 SMART
low complexity region 125 141 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
ZnF_U1 225 259 5.72e-4 SMART
ZnF_C2H2 228 252 7.11e0 SMART
ZnF_U1 294 328 7.44e-3 SMART
ZnF_C2H2 297 321 4.34e0 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 382 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107376
SMART Domains Protein: ENSMUSP00000102999
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 168 5.6e-9 PFAM
Pfam:Miro 6 123 2.2e-21 PFAM
Pfam:Ras 6 170 4.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127547
Predicted Effect probably benign
Transcript: ENSMUST00000142993
SMART Domains Protein: ENSMUSP00000114456
Gene: ENSMUSG00000017837

DomainStartEndE-ValueType
Pfam:Arf 1 151 1.3e-8 PFAM
Pfam:Miro 6 123 1.4e-21 PFAM
Pfam:MMR_HSR1 6 145 4.5e-6 PFAM
Pfam:Ras 6 153 2.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148560
Predicted Effect probably null
Transcript: ENSMUST00000151589
SMART Domains Protein: ENSMUSP00000119259
Gene: ENSMUSG00000014198

DomainStartEndE-ValueType
ZnF_U1 40 74 6.04e-3 SMART
ZnF_C2H2 43 67 6.31e1 SMART
low complexity region 79 104 N/A INTRINSIC
ZnF_U1 152 188 4.36e-2 SMART
ZnF_C2H2 157 179 1.51e0 SMART
low complexity region 205 221 N/A INTRINSIC
low complexity region 223 241 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155840
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Arrdc1 T C 2: 24,926,140 I284V probably benign Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Nkiras2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Nkiras2 APN 11 100624982 missense probably damaging 0.97
IGL03080:Nkiras2 APN 11 100624279 unclassified probably null
R0543:Nkiras2 UTSW 11 100624192 unclassified probably benign
R0733:Nkiras2 UTSW 11 100624932 unclassified probably null
R1698:Nkiras2 UTSW 11 100625163 missense probably damaging 1.00
R5727:Nkiras2 UTSW 11 100625027 missense probably damaging 1.00
R5973:Nkiras2 UTSW 11 100626040 missense probably damaging 0.99
R6427:Nkiras2 UTSW 11 100625035 missense probably damaging 1.00
R8022:Nkiras2 UTSW 11 100624287 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACATGAAGCGCGGTCTAGTTTTCC -3'
(R):5'- AGGGCAGCTATTCAGCCATCCAAG -3'

Sequencing Primer
(F):5'- GCGGTCTAGTTTTCCTTCTCTG -3'
(R):5'- AAGGCAGACTTGCTCTGCG -3'
Posted On2014-01-15