Incidental Mutation 'R1193:Pik3ca'
ID 100927
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
Synonyms 6330412C24Rik, caPI3K, p110alpha
MMRRC Submission 039265-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1193 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 32451203-32520256 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32510242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 806 (D806G)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
AlphaFold P42337
Predicted Effect probably damaging
Transcript: ENSMUST00000029201
AA Change: D806G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: D806G

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108242
AA Change: D684G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: D684G

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108243
AA Change: D806G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: D806G

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192994
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,766,293 (GRCm39) D49G probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Gpm6a A T 8: 55,500,268 (GRCm39) probably null Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nudt5 G A 2: 5,868,411 (GRCm39) S103N probably benign Het
Or5an9 A T 19: 12,187,803 (GRCm39) Y291F probably damaging Het
Or6z3 A G 7: 6,463,715 (GRCm39) N69S probably benign Het
Pds5a G T 5: 65,795,145 (GRCm39) A697E probably damaging Het
Rars1 C T 11: 35,700,153 (GRCm39) A548T possibly damaging Het
Rfk C T 19: 17,372,685 (GRCm39) P69L probably damaging Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Sp4 C T 12: 118,262,981 (GRCm39) R355H possibly damaging Het
Tcaim T C 9: 122,647,895 (GRCm39) Y137H probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tmem150c T C 5: 100,231,451 (GRCm39) T175A probably damaging Het
Twnk A G 19: 44,996,229 (GRCm39) K221E probably damaging Het
Vmn2r67 T C 7: 84,800,653 (GRCm39) K428E probably damaging Het
Vmn2r82 T A 10: 79,213,739 (GRCm39) Y108* probably null Het
Wwox G A 8: 115,406,614 (GRCm39) V202M probably benign Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32,516,733 (GRCm39) missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32,504,175 (GRCm39) missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32,514,084 (GRCm39) missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32,494,035 (GRCm39) missense probably benign 0.27
IGL03401:Pik3ca APN 3 32,491,963 (GRCm39) splice site probably null
Interrupted UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
Lilfella UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
Peninsular UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
Severed UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R0084:Pik3ca UTSW 3 32,516,937 (GRCm39) missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32,514,094 (GRCm39) missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32,493,902 (GRCm39) missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32,515,660 (GRCm39) missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32,504,410 (GRCm39) critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32,490,701 (GRCm39) missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32,504,176 (GRCm39) missense possibly damaging 0.91
R1292:Pik3ca UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32,504,499 (GRCm39) missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32,498,016 (GRCm39) missense probably benign 0.27
R1969:Pik3ca UTSW 3 32,505,903 (GRCm39) critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32,504,206 (GRCm39) missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32,516,943 (GRCm39) nonsense probably null
R2680:Pik3ca UTSW 3 32,498,034 (GRCm39) missense probably benign 0.00
R2680:Pik3ca UTSW 3 32,490,697 (GRCm39) nonsense probably null
R3001:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32,494,084 (GRCm39) nonsense probably null
R4416:Pik3ca UTSW 3 32,515,679 (GRCm39) missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32,492,127 (GRCm39) missense probably benign 0.20
R4822:Pik3ca UTSW 3 32,492,131 (GRCm39) missense probably benign 0.04
R4856:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32,504,202 (GRCm39) missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32,515,709 (GRCm39) missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32,516,928 (GRCm39) missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32,515,712 (GRCm39) missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32,494,863 (GRCm39) critical splice donor site probably null
R6347:Pik3ca UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
R6538:Pik3ca UTSW 3 32,493,853 (GRCm39) missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32,490,428 (GRCm39) missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32,490,367 (GRCm39) missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32,497,762 (GRCm39) nonsense probably null
R8218:Pik3ca UTSW 3 32,491,996 (GRCm39) missense possibly damaging 0.74
R8478:Pik3ca UTSW 3 32,505,997 (GRCm39) missense probably benign
R9100:Pik3ca UTSW 3 32,514,168 (GRCm39) missense probably damaging 1.00
R9169:Pik3ca UTSW 3 32,503,755 (GRCm39) critical splice donor site probably null
R9255:Pik3ca UTSW 3 32,496,981 (GRCm39) critical splice donor site probably null
R9267:Pik3ca UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
R9278:Pik3ca UTSW 3 32,508,587 (GRCm39) missense probably damaging 1.00
R9501:Pik3ca UTSW 3 32,504,062 (GRCm39) missense probably damaging 1.00
R9555:Pik3ca UTSW 3 32,505,916 (GRCm39) missense probably damaging 1.00
Z1177:Pik3ca UTSW 3 32,492,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCCAGGATTGCCTTATAACC -3'
(R):5'- GATGGGCGACCTTAAGACACTCAC -3'

Sequencing Primer
(F):5'- GGATTGCCTTATAACCAAATTTAGAC -3'
(R):5'- AGACGAGTCTCTTCAGCTATTG -3'
Posted On 2014-01-15