Incidental Mutation 'R1193:Olfr1431'
ID100963
Institutional Source Beutler Lab
Gene Symbol Olfr1431
Ensembl Gene ENSMUSG00000094133
Gene Nameolfactory receptor 1431
SynonymsGA_x6K02T2RE5P-2573738-2574676, MOR214-5
MMRRC Submission 039265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1193 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12200634-12212191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12210439 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 291 (Y291F)
Ref Sequence ENSEMBL: ENSMUSP00000150967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072316] [ENSMUST00000213759]
Predicted Effect probably damaging
Transcript: ENSMUST00000072316
AA Change: Y291F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072158
Gene: ENSMUSG00000094133
AA Change: Y291F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.4e-56 PFAM
Pfam:7tm_1 42 309 2.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213759
AA Change: Y291F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214138
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,712,144 D49G probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Gpm6a A T 8: 55,047,233 probably null Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt5 G A 2: 5,863,600 S103N probably benign Het
Olfr1336 A G 7: 6,460,716 N69S probably benign Het
Pds5a G T 5: 65,637,802 A697E probably damaging Het
Pik3ca A G 3: 32,456,093 D806G probably damaging Het
Rars C T 11: 35,809,326 A548T possibly damaging Het
Rfk C T 19: 17,395,321 P69L probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sp4 C T 12: 118,299,246 R355H possibly damaging Het
Tcaim T C 9: 122,818,830 Y137H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem150c T C 5: 100,083,592 T175A probably damaging Het
Twnk A G 19: 45,007,790 K221E probably damaging Het
Vmn2r67 T C 7: 85,151,445 K428E probably damaging Het
Vmn2r82 T A 10: 79,377,905 Y108* probably null Het
Wwox G A 8: 114,679,874 V202M probably benign Het
Other mutations in Olfr1431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Olfr1431 APN 19 12210040 missense possibly damaging 0.65
IGL02206:Olfr1431 APN 19 12210460 missense probably damaging 1.00
IGL02938:Olfr1431 APN 19 12209682 missense probably benign 0.00
PIT4812001:Olfr1431 UTSW 19 12210253 missense probably damaging 1.00
R0402:Olfr1431 UTSW 19 12209589 missense probably damaging 1.00
R0661:Olfr1431 UTSW 19 12209704 missense probably damaging 1.00
R1483:Olfr1431 UTSW 19 12209750 nonsense probably null
R4091:Olfr1431 UTSW 19 12209779 missense probably damaging 1.00
R4280:Olfr1431 UTSW 19 12209938 missense probably damaging 1.00
R5028:Olfr1431 UTSW 19 12210154 missense possibly damaging 0.94
R5540:Olfr1431 UTSW 19 12210460 missense probably damaging 1.00
R6042:Olfr1431 UTSW 19 12209922 missense probably damaging 0.99
R6045:Olfr1431 UTSW 19 12210295 missense probably damaging 1.00
R7104:Olfr1431 UTSW 19 12209878 missense possibly damaging 0.82
Z1088:Olfr1431 UTSW 19 12210490 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GATCACTTCAGCTAAAGGCAGGTCC -3'
(R):5'- ACAGGTTCAGGCTTCCACAACTTTC -3'

Sequencing Primer
(F):5'- CTAAAGGCAGGTCCAAGGC -3'
(R):5'- CGATGACATCAAATCCATTGTTGG -3'
Posted On2014-01-15