Incidental Mutation 'R1194:Spon1'
ID 100985
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
MMRRC Submission 039266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R1194 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113886798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 194 (R194G)
Ref Sequence ENSEMBL: ENSMUSP00000081746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687] [ENSMUST00000084696]
AlphaFold Q8VCC9
Predicted Effect probably benign
Transcript: ENSMUST00000046687
AA Change: R194G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: R194G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084696
AA Change: R194G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081746
Gene: ENSMUSG00000038156
AA Change: R194G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 43 173 1.5e-35 PFAM
Pfam:Spond_N 204 281 1.3e-31 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029F12Rik T C 13: 97,030,365 R48G unknown Het
Dock4 T C 12: 40,829,616 F1533S probably damaging Het
Dsg3 A G 18: 20,525,220 E296G probably damaging Het
Ehhadh T C 16: 21,762,091 K717R probably benign Het
Emx2 C T 19: 59,459,552 Q12* probably null Het
Fubp1 TA T 3: 152,231,969 probably null Het
Gtsf1 A G 15: 103,425,474 I25T probably damaging Het
Krt78 A G 15: 101,951,786 S232P probably damaging Het
Myh4 G A 11: 67,255,734 probably null Het
Nkapl A G 13: 21,468,308 L45P unknown Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr165 T A 16: 19,407,180 T280S possibly damaging Het
Prkg2 A G 5: 98,971,926 S445P probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc12a1 G A 2: 125,184,767 V441I probably benign Het
Slc7a15 T A 12: 8,535,772 T8S probably damaging Het
Syne2 T C 12: 75,934,513 Y1531H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAAAGTCGTCTCACCCTAGAG -3'
(R):5'- CAAGCATTAGCAATGTGCTTCCCC -3'

Sequencing Primer
(F):5'- TTGGTTCCATAGAACACCTCAG -3'
(R):5'- TTCCCCTGACCCGTAAAGTAG -3'
Posted On 2014-01-15