Mutagenetix > Incidental Mutations

Incidental Mutation 'R1194:Spon1'

100985

Institutional Source

Beutler Lab

Gene Symbol

Spon1

Ensembl Gene

ENSMUSG00000038156

Gene Name

spondin 1, (f-spondin) extracellular matrix protein

Synonyms

FSP, D330035F22Rik

MMRRC Submission

039266-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.239) question?

Stock #

R1194 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113765998-114043370 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113886798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 194 (R194G)

Ref Sequence

ENSEMBL: ENSMUSP00000081746 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046687] [ENSMUST00000084696]

AlphaFold

Q8VCC9

Predicted Effect

probably benign
Transcript: ENSMUST00000046687
AA Change: R194G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: R194G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Reeler	44	172	1e-24	PFAM
Pfam:Spond_N	205	399	7.5e-74	PFAM
low complexity region	431	442	N/A	INTRINSIC
TSP1	445	495	7.92e-8	SMART
TSP1	504	555	6.57e-14	SMART
TSP1	561	611	2.29e-13	SMART
TSP1	617	666	1.45e-15	SMART
TSP1	671	721	1.21e-12	SMART
low complexity region	730	747	N/A	INTRINSIC
TSP1	757	806	3.12e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084696
AA Change: R194G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081746
Gene: ENSMUSG00000038156
AA Change: R194G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Reeler	43	173	1.5e-35	PFAM
Pfam:Spond_N	204	281	1.3e-31	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 90.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029F12Rik	T	C	13: 97,030,365	R48G	unknown	Het
Dock4	T	C	12: 40,829,616	F1533S	probably damaging	Het
Dsg3	A	G	18: 20,525,220	E296G	probably damaging	Het
Ehhadh	T	C	16: 21,762,091	K717R	probably benign	Het
Emx2	C	T	19: 59,459,552	Q12*	probably null	Het
Fubp1	TA	T	3: 152,231,969		probably null	Het
Gtsf1	A	G	15: 103,425,474	I25T	probably damaging	Het
Krt78	A	G	15: 101,951,786	S232P	probably damaging	Het
Myh4	G	A	11: 67,255,734		probably null	Het
Nkapl	A	G	13: 21,468,308	L45P	unknown	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Olfr165	T	A	16: 19,407,180	T280S	possibly damaging	Het
Prkg2	A	G	5: 98,971,926	S445P	probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slc12a1	G	A	2: 125,184,767	V441I	probably benign	Het
Slc7a15	T	A	12: 8,535,772	T8S	probably damaging	Het
Syne2	T	C	12: 75,934,513	Y1531H	probably damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het

Other mutations in Spon1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Spon1	APN	7	114034290	missense	probably damaging	1.00
IGL02385:Spon1	APN	7	113766330	start codon destroyed	probably null	0.56
IGL02496:Spon1	APN	7	114036662	missense	probably benign	0.00
IGL02562:Spon1	APN	7	114036761	missense	probably benign	0.12
IGL03063:Spon1	APN	7	114033025	missense	possibly damaging	0.85
IGL03153:Spon1	APN	7	114030344	missense	probably damaging	1.00
IGL03392:Spon1	APN	7	114034287	missense	probably damaging	0.99
Rust	UTSW	7	114016791	missense	possibly damaging	0.77
Wilt	UTSW	7	113766384	missense	probably damaging	0.98
R0512:Spon1	UTSW	7	113836833	missense	possibly damaging	0.59
R0646:Spon1	UTSW	7	114039821	missense	probably benign	0.04
R1832:Spon1	UTSW	7	114016785	missense	probably benign	0.26
R2391:Spon1	UTSW	7	113886847	missense	probably damaging	1.00
R3747:Spon1	UTSW	7	113766384	missense	probably damaging	0.98
R3747:Spon1	UTSW	7	114016791	missense	possibly damaging	0.77
R3749:Spon1	UTSW	7	113766384	missense	probably damaging	0.98
R3749:Spon1	UTSW	7	114016791	missense	possibly damaging	0.77
R3750:Spon1	UTSW	7	113766384	missense	probably damaging	0.98
R3750:Spon1	UTSW	7	114016791	missense	possibly damaging	0.77
R4666:Spon1	UTSW	7	114028969	missense	probably benign	0.20
R4730:Spon1	UTSW	7	114033071	missense	possibly damaging	0.92
R4774:Spon1	UTSW	7	114039867	missense	probably damaging	0.99
R5855:Spon1	UTSW	7	114029072	missense	probably damaging	0.99
R5870:Spon1	UTSW	7	114031786	missense	probably damaging	1.00
R5914:Spon1	UTSW	7	114030821	missense	probably damaging	1.00
R6523:Spon1	UTSW	7	113886785	missense	probably benign	0.00
R7138:Spon1	UTSW	7	114036710	missense	probably damaging	1.00
R7295:Spon1	UTSW	7	114030240	missense	possibly damaging	0.85
R7844:Spon1	UTSW	7	114030332	missense	probably benign	0.01
R8064:Spon1	UTSW	7	114036621	missense	probably damaging	1.00
R8075:Spon1	UTSW	7	114016793	critical splice donor site	probably null
R8927:Spon1	UTSW	7	114030357	critical splice donor site	probably null
R8928:Spon1	UTSW	7	114030357	critical splice donor site	probably null
R9278:Spon1	UTSW	7	114028953	missense	probably damaging	1.00
Z1088:Spon1	UTSW	7	113766386	missense	possibly damaging	0.83
Z1176:Spon1	UTSW	7	113927794	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAAAGTCGTCTCACCCTAGAG -3'
(R):5'- CAAGCATTAGCAATGTGCTTCCCC -3'

Sequencing Primer
(F):5'- TTGGTTCCATAGAACACCTCAG -3'
(R):5'- TTCCCCTGACCCGTAAAGTAG -3'

Posted On

2014-01-15