Incidental Mutation 'R1194:Emx2'
ID101015
Institutional Source Beutler Lab
Gene Symbol Emx2
Ensembl Gene ENSMUSG00000043969
Gene Nameempty spiracles homeobox 2
SynonymsPdo
MMRRC Submission 039266-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1194 (G1)
Quality Score161
Status Not validated
Chromosome19
Chromosomal Location59458372-59465357 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 59459552 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 12 (Q12*)
Ref Sequence ENSEMBL: ENSMUSP00000140271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062216] [ENSMUST00000174353]
Predicted Effect probably null
Transcript: ENSMUST00000062216
AA Change: Q113*
SMART Domains Protein: ENSMUSP00000053361
Gene: ENSMUSG00000043969
AA Change: Q113*

DomainStartEndE-ValueType
low complexity region 76 109 N/A INTRINSIC
HOX 155 217 1.32e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136990
Predicted Effect probably null
Transcript: ENSMUST00000174353
AA Change: Q12*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174573
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous disruption of this gene causes neonatal death, impaired urogenital development and malformation of several forebrain regions. Heterozygotes for a null allele show middle and inner ear defects. Homozygotes for an ENU-induced allele die neonatally with middle ear defects and small kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029F12Rik T C 13: 97,030,365 R48G unknown Het
Dock4 T C 12: 40,829,616 F1533S probably damaging Het
Dsg3 A G 18: 20,525,220 E296G probably damaging Het
Ehhadh T C 16: 21,762,091 K717R probably benign Het
Fubp1 TA T 3: 152,231,969 probably null Het
Gtsf1 A G 15: 103,425,474 I25T probably damaging Het
Krt78 A G 15: 101,951,786 S232P probably damaging Het
Myh4 G A 11: 67,255,734 probably null Het
Nkapl A G 13: 21,468,308 L45P unknown Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr165 T A 16: 19,407,180 T280S possibly damaging Het
Prkg2 A G 5: 98,971,926 S445P probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc12a1 G A 2: 125,184,767 V441I probably benign Het
Slc7a15 T A 12: 8,535,772 T8S probably damaging Het
Spon1 A G 7: 113,886,798 R194G probably benign Het
Syne2 T C 12: 75,934,513 Y1531H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Other mutations in Emx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Emx2 APN 19 59459589 missense possibly damaging 0.83
IGL02103:Emx2 APN 19 59461698 missense probably benign 0.22
R0446:Emx2 UTSW 19 59463916 nonsense probably null
R0631:Emx2 UTSW 19 59464028 missense probably damaging 1.00
R1512:Emx2 UTSW 19 59459603 missense possibly damaging 0.95
R1526:Emx2 UTSW 19 59464010 missense probably benign 0.05
R2019:Emx2 UTSW 19 59459339 missense probably benign
R2066:Emx2 UTSW 19 59461698 missense probably benign 0.01
R2133:Emx2 UTSW 19 59464033 missense probably damaging 0.99
R4977:Emx2 UTSW 19 59459246 missense probably damaging 1.00
R5884:Emx2 UTSW 19 59464029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCGTTTGGTGCAAGATTCTC -3'
(R):5'- GCTGCCCAGTTTCAGAACCAAGAAC -3'

Sequencing Primer
(F):5'- tcctttcctttcttccttccttc -3'
(R):5'- CTTCAGTTCCGCGACGT -3'
Posted On2014-01-15