Incidental Mutation 'R1195:Cd28'
ID101021
Institutional Source Beutler Lab
Gene Symbol Cd28
Ensembl Gene ENSMUSG00000026012
Gene NameCD28 antigen
Synonyms
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location60716800-60773359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60763144 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 74 (T74I)
Ref Sequence ENSEMBL: ENSMUSP00000027165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027165
AA Change: T74I

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027165
Gene: ENSMUSG00000026012
AA Change: T74I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 26 137 2.57e0 SMART
transmembrane domain 154 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153207
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for T-cell proliferation and survival, cytokine production, and T-helper type-2 development. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous mutation of this gene results in impairment of some T cell responses and decreased basal immunoglobulin levels. Mutant animals have reduced T helper cell activity and impaired T cell response to lectins, but cytotoxic T cells can still be induced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Cd28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Cd28 APN 1 60763148 nonsense probably null
IGL02211:Cd28 APN 1 60762994 missense probably damaging 1.00
IGL02598:Cd28 APN 1 60763339 splice site probably benign
Iago UTSW 1 60763173 nonsense probably null
Othello UTSW 1 60763328 missense possibly damaging 0.87
R1195:Cd28 UTSW 1 60763144 missense possibly damaging 0.95
R1195:Cd28 UTSW 1 60763144 missense possibly damaging 0.95
R4472:Cd28 UTSW 1 60763234 missense probably benign 0.00
R4877:Cd28 UTSW 1 60769702 missense possibly damaging 0.95
R6410:Cd28 UTSW 1 60765283 missense probably benign 0.05
R7201:Cd28 UTSW 1 60763173 nonsense probably null
R7421:Cd28 UTSW 1 60763300 missense probably benign 0.20
R7544:Cd28 UTSW 1 60769700 missense probably damaging 1.00
R7596:Cd28 UTSW 1 60763328 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGATTTTGGTAAAGCAGTCGCCCC -3'
(R):5'- AGTCTCAGATCACATGCGAGAGCC -3'

Sequencing Primer
(F):5'- CCTGCTTGTGGTAGATAGCAAC -3'
(R):5'- CAACCGTCCTTTAGGTTACAGGAG -3'
Posted On2014-01-15