Incidental Mutation 'R1195:Zfp639'
ID101028
Institutional Source Beutler Lab
Gene Symbol Zfp639
Ensembl Gene ENSMUSG00000027667
Gene Namezinc finger protein 639
Synonyms6230400O18Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32510259-32520833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32519196 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 86 (V86I)
Ref Sequence ENSEMBL: ENSMUSP00000142244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029203] [ENSMUST00000191783] [ENSMUST00000192985] [ENSMUST00000193119] [ENSMUST00000193287]
Predicted Effect probably benign
Transcript: ENSMUST00000029203
AA Change: V86I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029203
Gene: ENSMUSG00000027667
AA Change: V86I

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191783
AA Change: V86I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141446
Gene: ENSMUSG00000027667
AA Change: V86I

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192985
AA Change: V42I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000193119
AA Change: V86I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000193287
AA Change: V86I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141341
Gene: ENSMUSG00000027667
AA Change: V86I

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193290
Predicted Effect unknown
Transcript: ENSMUST00000193789
AA Change: V49I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194126
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like zinc finger family of proteins. Amplification and overexpression of this gene have been observed in esophageal squamous cell carcinoma. The encoded protein has been shown to bind DNA in a sequence-specific manner and may regulate HIV-1 gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Other mutations in Zfp639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp639 APN 3 32519753 splice site probably null
IGL00571:Zfp639 APN 3 32519919 missense probably damaging 0.99
IGL00579:Zfp639 APN 3 32520477 missense probably damaging 0.98
IGL01952:Zfp639 APN 3 32515347 missense probably damaging 1.00
PIT4514001:Zfp639 UTSW 3 32520260 missense possibly damaging 0.46
R0412:Zfp639 UTSW 3 32517110 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R2906:Zfp639 UTSW 3 32519751 missense probably damaging 0.99
R4660:Zfp639 UTSW 3 32520530 missense probably damaging 0.99
R5109:Zfp639 UTSW 3 32520436 splice site probably null
R6012:Zfp639 UTSW 3 32519122 missense probably damaging 1.00
R6321:Zfp639 UTSW 3 32517088 missense probably damaging 1.00
R6449:Zfp639 UTSW 3 32519661 missense possibly damaging 0.92
R7020:Zfp639 UTSW 3 32520112 missense probably damaging 0.98
R8034:Zfp639 UTSW 3 32520066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACACATGTTGCCGTCCAGTTT -3'
(R):5'- AACAGCCGTCCTCACTGCTGTA -3'

Sequencing Primer
(F):5'- CCTTAAGCTCCTTAGGATGTTCAGAG -3'
(R):5'- TGTAGCACTGCACTTAATAAGCC -3'
Posted On2014-01-15