Incidental Mutation 'R1195:Kdm4d'
ID101055
Institutional Source Beutler Lab
Gene Symbol Kdm4d
Ensembl Gene ENSMUSG00000053914
Gene Namelysine (K)-specific demethylase 4D
SynonymsJmjd2d
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14462548-14500482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14463099 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 488 (S488P)
Ref Sequence ENSEMBL: ENSMUSP00000061632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058796] [ENSMUST00000115647]
Predicted Effect probably benign
Transcript: ENSMUST00000058796
AA Change: S488P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061632
Gene: ENSMUSG00000053914
AA Change: S488P

DomainStartEndE-ValueType
Pfam:JmjN 16 50 3.3e-15 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115647
SMART Domains Protein: ENSMUSP00000111311
Gene: ENSMUSG00000053914

DomainStartEndE-ValueType
Pfam:JmjN 16 50 1.1e-16 PFAM
JmjC 143 309 2.3e-57 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of histone 3 methylation in spermatids, a transient increase in testes size, wider tubules, occasional male germ cell apoptosis, and decreased body weight. However, fertility is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Kdm4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kdm4d APN 9 14464219 missense probably benign 0.10
IGL01114:Kdm4d APN 9 14464197 missense probably damaging 1.00
IGL01609:Kdm4d APN 9 14464418 missense probably damaging 0.99
IGL02342:Kdm4d APN 9 14463564 missense probably damaging 0.99
IGL02513:Kdm4d APN 9 14464554 missense probably benign 0.00
IGL03276:Kdm4d APN 9 14464542 missense probably benign 0.04
IGL03379:Kdm4d APN 9 14463843 missense probably damaging 1.00
R0220:Kdm4d UTSW 9 14463122 missense probably benign
R0755:Kdm4d UTSW 9 14464295 missense probably damaging 0.99
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1195:Kdm4d UTSW 9 14463099 missense probably benign
R1455:Kdm4d UTSW 9 14464395 missense probably damaging 0.98
R1552:Kdm4d UTSW 9 14464029 missense probably damaging 1.00
R1692:Kdm4d UTSW 9 14464511 missense probably benign 0.43
R1871:Kdm4d UTSW 9 14464383 missense probably damaging 1.00
R1892:Kdm4d UTSW 9 14464317 missense probably benign 0.14
R4792:Kdm4d UTSW 9 14463390 missense probably benign
R5113:Kdm4d UTSW 9 14464113 missense probably damaging 1.00
R5211:Kdm4d UTSW 9 14463104 missense probably benign 0.04
R5352:Kdm4d UTSW 9 14464358 missense probably damaging 1.00
R6692:Kdm4d UTSW 9 14463065 missense probably benign
R7014:Kdm4d UTSW 9 14464179 missense probably damaging 0.99
R7198:Kdm4d UTSW 9 14464020 missense probably damaging 1.00
R7260:Kdm4d UTSW 9 14463158 missense probably benign 0.05
R8116:Kdm4d UTSW 9 14463941 missense probably damaging 1.00
R8134:Kdm4d UTSW 9 14463236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATGTCCTGCAAACTCAGTC -3'
(R):5'- TCCAGGCAACCATCAGATGTGAAAG -3'

Sequencing Primer
(F):5'- CTCAGTCAAAACTATGAGGTAATGG -3'
(R):5'- GATGATGTCCAGAAGTCTGACTC -3'
Posted On2014-01-15