Incidental Mutation 'R1195:Elmod1'
ID101057
Institutional Source Beutler Lab
Gene Symbol Elmod1
Ensembl Gene ENSMUSG00000041986
Gene NameELMO/CED-12 domain containing 1
Synonyms
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53911457-53975301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53935768 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 42 (Y42C)
Ref Sequence ENSEMBL: ENSMUSP00000129082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048409] [ENSMUST00000166580]
Predicted Effect probably damaging
Transcript: ENSMUST00000048409
AA Change: Y42C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046191
Gene: ENSMUSG00000041986
AA Change: Y42C

DomainStartEndE-ValueType
Pfam:ELMO_CED12 117 295 3.8e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166580
AA Change: Y42C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129082
Gene: ENSMUSG00000041986
AA Change: Y42C

DomainStartEndE-ValueType
Pfam:ELMO_CED12 114 296 9.6e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215313
Meta Mutation Damage Score 0.2960 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele exhibit circling, absent startle reflex, deafness, organ of Corti degeneration and abnormal cochlear hair stereociliary bundle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Elmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Elmod1 APN 9 53924398 critical splice donor site probably null
IGL01803:Elmod1 APN 9 53931480 missense probably benign 0.01
IGL01966:Elmod1 APN 9 53921327 missense probably benign 0.00
IGL02354:Elmod1 APN 9 53931558 missense probably damaging 1.00
IGL02361:Elmod1 APN 9 53931558 missense probably damaging 1.00
IGL03107:Elmod1 APN 9 53934223 splice site probably benign
IGL03277:Elmod1 APN 9 53925988 missense probably damaging 1.00
R0013:Elmod1 UTSW 9 53912901 splice site probably benign
R0013:Elmod1 UTSW 9 53912901 splice site probably benign
R0243:Elmod1 UTSW 9 53935547 splice site probably benign
R0530:Elmod1 UTSW 9 53925976 missense probably damaging 0.96
R0555:Elmod1 UTSW 9 53931592 splice site probably benign
R0592:Elmod1 UTSW 9 53926106 splice site probably benign
R0670:Elmod1 UTSW 9 53912822 missense probably damaging 0.96
R1054:Elmod1 UTSW 9 53912774 missense probably benign 0.02
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1875:Elmod1 UTSW 9 53935867 missense probably benign 0.00
R4445:Elmod1 UTSW 9 53934129 missense probably damaging 1.00
R4573:Elmod1 UTSW 9 53925972 missense probably damaging 1.00
R5895:Elmod1 UTSW 9 53935807 missense probably damaging 0.99
R6826:Elmod1 UTSW 9 53919599 missense probably benign 0.02
R7181:Elmod1 UTSW 9 53934098 splice site probably null
R7334:Elmod1 UTSW 9 53934224 splice site probably null
R7422:Elmod1 UTSW 9 53912843 missense probably damaging 0.99
R7964:Elmod1 UTSW 9 53931576 missense probably benign 0.00
Z1088:Elmod1 UTSW 9 53919614 missense probably benign 0.00
Z1176:Elmod1 UTSW 9 53946860 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTCTCAGTGACGTTTCTGTTAAGGCAA -3'
(R):5'- CCGGAGTGGAGTAATGAACACCCA -3'

Sequencing Primer
(F):5'- CGTTTCTGTTAAGGCAATAACATAC -3'
(R):5'- CATGGACGCTGAAATCTAATGGC -3'
Posted On2014-01-15