Incidental Mutation 'R1167:Rftn2'
ID 101062
Institutional Source Beutler Lab
Gene Symbol Rftn2
Ensembl Gene ENSMUSG00000025978
Gene Name raftlin family member 2
Synonyms 3222401M22Rik, 2700010E02Rik
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 55209318-55265941 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55243458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 270 (T270M)
Ref Sequence ENSEMBL: ENSMUSP00000110071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027121] [ENSMUST00000114428] [ENSMUST00000132055]
AlphaFold Q8CHX7
Predicted Effect probably damaging
Transcript: ENSMUST00000027121
AA Change: T270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027121
Gene: ENSMUSG00000025978
AA Change: T270M

DomainStartEndE-ValueType
Pfam:Raftlin 1 439 2e-180 PFAM
low complexity region 467 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114428
AA Change: T270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110071
Gene: ENSMUSG00000025978
AA Change: T270M

DomainStartEndE-ValueType
Pfam:Raftlin 1 319 8.4e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133294
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Rftn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Rftn2 APN 1 55,243,444 (GRCm39) missense probably damaging 1.00
IGL01691:Rftn2 APN 1 55,253,445 (GRCm39) missense probably damaging 1.00
IGL02412:Rftn2 APN 1 55,245,497 (GRCm39) missense probably benign 0.01
IGL02458:Rftn2 APN 1 55,250,351 (GRCm39) nonsense probably null
1mM(1):Rftn2 UTSW 1 55,245,754 (GRCm39) missense possibly damaging 0.94
R0446:Rftn2 UTSW 1 55,253,354 (GRCm39) missense probably damaging 0.99
R1172:Rftn2 UTSW 1 55,250,376 (GRCm39) missense probably damaging 0.99
R4171:Rftn2 UTSW 1 55,253,429 (GRCm39) missense probably damaging 1.00
R4350:Rftn2 UTSW 1 55,233,440 (GRCm39) missense probably damaging 1.00
R4487:Rftn2 UTSW 1 55,241,311 (GRCm39) missense possibly damaging 0.74
R4833:Rftn2 UTSW 1 55,253,399 (GRCm39) missense possibly damaging 0.56
R4863:Rftn2 UTSW 1 55,211,198 (GRCm39) missense probably benign 0.01
R5719:Rftn2 UTSW 1 55,253,445 (GRCm39) missense probably damaging 1.00
R6801:Rftn2 UTSW 1 55,233,418 (GRCm39) missense possibly damaging 0.91
R6937:Rftn2 UTSW 1 55,233,508 (GRCm39) critical splice acceptor site probably null
R6939:Rftn2 UTSW 1 55,233,508 (GRCm39) critical splice acceptor site probably null
R7344:Rftn2 UTSW 1 55,265,311 (GRCm39) nonsense probably null
R7401:Rftn2 UTSW 1 55,233,401 (GRCm39) critical splice donor site probably null
R7517:Rftn2 UTSW 1 55,234,708 (GRCm39) missense probably damaging 1.00
R8512:Rftn2 UTSW 1 55,253,324 (GRCm39) missense probably damaging 1.00
R9207:Rftn2 UTSW 1 55,224,149 (GRCm39) missense probably damaging 1.00
R9501:Rftn2 UTSW 1 55,241,355 (GRCm39) missense possibly damaging 0.66
X0022:Rftn2 UTSW 1 55,253,295 (GRCm39) missense probably benign 0.05
Predicted Primers
Posted On 2014-01-15