Mutagenetix > Incidental Mutation

Incidental Mutation 'R1167:Zer1'

101070

Institutional Source

Beutler Lab

Gene Symbol

Zer1

Ensembl Gene

ENSMUSG00000039686

Gene Name

zyg-11 related, cell cycle regulator

Synonyms

C230075L19Rik, Zyg11bl

MMRRC Submission

039240-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30097283-30124585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30108246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 351 (R351H)

Ref Sequence

ENSEMBL: ENSMUSP00000046441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]

AlphaFold

Q80ZJ6

Predicted Effect

probably benign
Transcript: ENSMUST00000044751
AA Change: R351H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: R351H

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	405	774	3e-15	SMART
Blast:ARM	440	480	2e-18	BLAST
Blast:ARM	524	569	4e-24	BLAST
Blast:ARM	571	613	6e-22	BLAST
Blast:ARM	617	656	7e-8	BLAST
Blast:ARM	686	724	6e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000113677
AA Change: R338H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: R338H

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	392	761	3e-15	SMART
Blast:ARM	427	467	2e-18	BLAST
Blast:ARM	511	556	4e-24	BLAST
Blast:ARM	558	600	2e-21	BLAST
Blast:ARM	604	643	7e-8	BLAST
Blast:ARM	673	711	6e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139128

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154231

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Zer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Zer1	APN	2	30108220	critical splice donor site	probably null
IGL01630:Zer1	APN	2	30101831	missense	probably damaging	1.00
IGL02126:Zer1	APN	2	30104916	missense	probably benign	0.10
IGL02338:Zer1	APN	2	30113393	missense	probably damaging	1.00
IGL02817:Zer1	APN	2	30103394	missense	probably damaging	0.99
PIT4402001:Zer1	UTSW	2	30101120	missense	probably damaging	0.96
PIT4495001:Zer1	UTSW	2	30103543	missense	probably benign	0.01
R0390:Zer1	UTSW	2	30108213	splice site	probably benign
R0506:Zer1	UTSW	2	30101807	missense	probably damaging	1.00
R0606:Zer1	UTSW	2	30104797	splice site	probably benign
R0928:Zer1	UTSW	2	30101763	critical splice donor site	probably null
R1819:Zer1	UTSW	2	30110218	missense	probably benign	0.18
R2040:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2041:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2042:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2092:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2168:Zer1	UTSW	2	30104875	missense	probably damaging	1.00
R2243:Zer1	UTSW	2	30101127	missense	probably damaging	0.99
R2254:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2255:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2311:Zer1	UTSW	2	30101822	missense	probably damaging	0.99
R2993:Zer1	UTSW	2	30101897	missense	probably damaging	1.00
R3010:Zer1	UTSW	2	30113285	missense	probably benign	0.13
R3731:Zer1	UTSW	2	30110911	missense	probably benign	0.44
R4038:Zer1	UTSW	2	30107523	missense	probably damaging	1.00
R5241:Zer1	UTSW	2	30104970	missense	probably damaging	1.00
R5433:Zer1	UTSW	2	30100986	intron	probably benign
R5443:Zer1	UTSW	2	30110996	missense	probably damaging	1.00
R5524:Zer1	UTSW	2	30104854	missense	probably damaging	1.00
R5936:Zer1	UTSW	2	30107667	missense	probably damaging	0.97
R5999:Zer1	UTSW	2	30104997	missense	probably damaging	1.00
R6598:Zer1	UTSW	2	30113274	missense	probably damaging	1.00
R6965:Zer1	UTSW	2	30101047	missense	possibly damaging	0.87
R7030:Zer1	UTSW	2	30111021	missense	probably benign	0.00
R7190:Zer1	UTSW	2	30103432	missense	probably damaging	1.00
R7218:Zer1	UTSW	2	30105012	missense	probably damaging	1.00
R7252:Zer1	UTSW	2	30101892	missense	probably damaging	0.99
R7383:Zer1	UTSW	2	30111241	missense	probably damaging	1.00
R7417:Zer1	UTSW	2	30102822	missense	probably damaging	1.00
R7459:Zer1	UTSW	2	30113325	missense	probably damaging	1.00
R7463:Zer1	UTSW	2	30113437	start gained	probably benign
R7466:Zer1	UTSW	2	30101484	splice site	probably null
R7477:Zer1	UTSW	2	30107976	missense	probably null	0.34
R7719:Zer1	UTSW	2	30111231	missense	probably damaging	1.00
R7813:Zer1	UTSW	2	30110373	missense	probably damaging	1.00
R7976:Zer1	UTSW	2	30107508	missense	probably damaging	0.99
R8239:Zer1	UTSW	2	30101135	critical splice acceptor site	probably null
R8350:Zer1	UTSW	2	30101850	missense	probably damaging	1.00
R8404:Zer1	UTSW	2	30105023	critical splice acceptor site	probably null
R8842:Zer1	UTSW	2	30111050	missense	possibly damaging	0.65
R8896:Zer1	UTSW	2	30103418	missense	probably damaging	0.99
R8906:Zer1	UTSW	2	30111023	missense	probably benign	0.31
R8929:Zer1	UTSW	2	30110869	missense	probably damaging	1.00
R9050:Zer1	UTSW	2	30111282	missense	probably damaging	1.00
R9066:Zer1	UTSW	2	30110674	missense	probably damaging	1.00
R9277:Zer1	UTSW	2	30111285	missense	probably benign	0.00
R9322:Zer1	UTSW	2	30110911	missense	probably benign	0.00
R9577:Zer1	UTSW	2	30101038	missense	probably damaging	1.00
R9733:Zer1	UTSW	2	30107631	missense	probably benign	0.00
X0026:Zer1	UTSW	2	30104895	missense	probably damaging	0.99

Predicted Primers

Posted On

2014-01-15