Incidental Mutation 'R1167:Slc4a10'
ID 101072
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Name solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms NCBE
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 61876806-62157074 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62058918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 142 (K142E)
Ref Sequence ENSEMBL: ENSMUSP00000108099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
AlphaFold Q5DTL9
Predicted Effect probably damaging
Transcript: ENSMUST00000054484
AA Change: K142E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: K142E

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102735
AA Change: K142E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: K142E

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112480
AA Change: K142E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: K142E

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62,120,345 (GRCm39) missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62,117,284 (GRCm39) missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62,083,653 (GRCm39) critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62,099,010 (GRCm39) missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62,021,101 (GRCm39) missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62,059,014 (GRCm39) missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62,098,515 (GRCm39) missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62,021,113 (GRCm39) missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62,117,260 (GRCm39) missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62,098,487 (GRCm39) missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62,119,091 (GRCm39) missense probably null 1.00
IGL03144:Slc4a10 APN 2 62,080,810 (GRCm39) missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62,127,304 (GRCm39) missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62,097,780 (GRCm39) missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62,080,887 (GRCm39) splice site probably benign
R0085:Slc4a10 UTSW 2 62,074,690 (GRCm39) splice site probably benign
R0401:Slc4a10 UTSW 2 62,021,192 (GRCm39) missense probably benign 0.27
R0433:Slc4a10 UTSW 2 62,120,327 (GRCm39) missense probably benign 0.01
R0482:Slc4a10 UTSW 2 62,127,361 (GRCm39) splice site probably benign
R0506:Slc4a10 UTSW 2 62,080,877 (GRCm39) missense probably benign 0.13
R0511:Slc4a10 UTSW 2 62,117,206 (GRCm39) missense probably damaging 0.97
R0590:Slc4a10 UTSW 2 62,021,237 (GRCm39) splice site probably benign
R0883:Slc4a10 UTSW 2 62,073,742 (GRCm39) missense probably benign 0.11
R1276:Slc4a10 UTSW 2 62,080,787 (GRCm39) missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62,143,630 (GRCm39) missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62,117,274 (GRCm39) missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62,087,806 (GRCm39) missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62,155,071 (GRCm39) missense probably benign
R1848:Slc4a10 UTSW 2 62,146,950 (GRCm39) missense probably damaging 1.00
R1987:Slc4a10 UTSW 2 62,098,548 (GRCm39) missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62,098,548 (GRCm39) missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62,064,725 (GRCm39) missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62,064,725 (GRCm39) missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62,143,687 (GRCm39) missense probably benign
R4067:Slc4a10 UTSW 2 61,876,989 (GRCm39) start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62,147,786 (GRCm39) intron probably benign
R4255:Slc4a10 UTSW 2 62,112,280 (GRCm39) missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62,074,687 (GRCm39) splice site probably null
R4296:Slc4a10 UTSW 2 62,064,772 (GRCm39) missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62,073,729 (GRCm39) missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62,127,202 (GRCm39) missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62,087,861 (GRCm39) missense probably null 1.00
R4755:Slc4a10 UTSW 2 62,127,332 (GRCm39) missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62,098,531 (GRCm39) missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62,087,939 (GRCm39) missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62,074,783 (GRCm39) missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62,097,915 (GRCm39) missense probably benign 0.06
R5223:Slc4a10 UTSW 2 62,083,710 (GRCm39) missense probably damaging 1.00
R5244:Slc4a10 UTSW 2 62,119,069 (GRCm39) missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62,120,402 (GRCm39) missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62,080,816 (GRCm39) missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62,073,775 (GRCm39) missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62,099,216 (GRCm39) missense probably benign 0.44
R6009:Slc4a10 UTSW 2 61,877,034 (GRCm39) missense probably benign 0.00
R6015:Slc4a10 UTSW 2 62,059,046 (GRCm39) missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62,064,809 (GRCm39) missense probably damaging 1.00
R6141:Slc4a10 UTSW 2 62,041,789 (GRCm39) missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62,073,701 (GRCm39) splice site probably null
R6217:Slc4a10 UTSW 2 62,134,295 (GRCm39) missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62,112,310 (GRCm39) missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62,117,305 (GRCm39) nonsense probably null
R6643:Slc4a10 UTSW 2 62,059,054 (GRCm39) missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62,080,747 (GRCm39) missense possibly damaging 0.55
R7008:Slc4a10 UTSW 2 62,117,266 (GRCm39) missense probably benign 0.00
R7083:Slc4a10 UTSW 2 62,064,839 (GRCm39) missense probably benign 0.03
R7223:Slc4a10 UTSW 2 62,099,009 (GRCm39) missense probably damaging 0.99
R7243:Slc4a10 UTSW 2 62,134,206 (GRCm39) missense probably damaging 1.00
R7449:Slc4a10 UTSW 2 62,134,290 (GRCm39) missense probably benign
R7621:Slc4a10 UTSW 2 62,080,823 (GRCm39) missense probably damaging 0.98
R7692:Slc4a10 UTSW 2 62,134,308 (GRCm39) missense possibly damaging 0.94
R7742:Slc4a10 UTSW 2 62,127,194 (GRCm39) missense probably damaging 1.00
R7905:Slc4a10 UTSW 2 62,098,495 (GRCm39) missense probably damaging 1.00
R8179:Slc4a10 UTSW 2 62,073,792 (GRCm39) missense possibly damaging 0.64
R8528:Slc4a10 UTSW 2 62,127,140 (GRCm39) missense possibly damaging 0.79
R8531:Slc4a10 UTSW 2 62,097,851 (GRCm39) missense probably damaging 1.00
R8772:Slc4a10 UTSW 2 62,134,284 (GRCm39) missense probably damaging 1.00
R9307:Slc4a10 UTSW 2 62,083,662 (GRCm39) missense probably damaging 1.00
R9531:Slc4a10 UTSW 2 62,099,154 (GRCm39) missense probably damaging 1.00
R9732:Slc4a10 UTSW 2 62,135,086 (GRCm39) missense probably damaging 0.97
U24488:Slc4a10 UTSW 2 61,877,002 (GRCm39) missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62,058,943 (GRCm39) missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62,058,915 (GRCm39) missense probably damaging 1.00
Z1176:Slc4a10 UTSW 2 62,074,760 (GRCm39) missense probably benign
Z1176:Slc4a10 UTSW 2 62,041,723 (GRCm39) missense probably damaging 1.00
Predicted Primers
Posted On 2014-01-15