Incidental Mutation 'R1195:Hdac5'
ID101073
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Namehistone deacetylase 5
SynonymsmHDA1
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102194432-102230166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102205506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 310 (I310V)
Ref Sequence ENSEMBL: ENSMUSP00000008999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000131254] [ENSMUST00000156337]
Predicted Effect probably damaging
Transcript: ENSMUST00000008999
AA Change: I310V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855
AA Change: I310V

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107150
AA Change: I291V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855
AA Change: I291V

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107151
AA Change: I292V

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855
AA Change: I292V

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107152
AA Change: I292V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855
AA Change: I292V

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131254
SMART Domains Protein: ENSMUSP00000118108
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
Pfam:HDAC4_Gln 57 146 1.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150683
Predicted Effect probably benign
Transcript: ENSMUST00000156337
SMART Domains Protein: ENSMUSP00000116646
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:HDAC4_Gln 25 114 2e-38 PFAM
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0612:Hdac5 UTSW 11 102196252 missense possibly damaging 0.92
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1673:Hdac5 UTSW 11 102198805 missense probably damaging 1.00
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R2518:Hdac5 UTSW 11 102197136 missense probably damaging 1.00
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4682:Hdac5 UTSW 11 102206630 missense probably null 0.99
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R4991:Hdac5 UTSW 11 102205624 missense probably damaging 1.00
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6615:Hdac5 UTSW 11 102197056 splice site probably null
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
R8140:Hdac5 UTSW 11 102197355 missense probably damaging 1.00
R8151:Hdac5 UTSW 11 102206468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAGTAAAGCCGTTCTCAGC -3'
(R):5'- ATGACAGCCGTGATGACTTTCCC -3'

Sequencing Primer
(F):5'- CCGTTCTCAGCGATGGTG -3'
(R):5'- GTCTTGGCTCCCAGGAATAAG -3'
Posted On2014-01-15