Incidental Mutation 'R1167:Ola1'
ID101074
Institutional Source Beutler Lab
Gene Symbol Ola1
Ensembl Gene ENSMUSG00000027108
Gene NameObg-like ATPase 1
Synonyms2510025G09Rik, 2810409H07Rik, 2810405J23Rik, Gtpbp9
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73092801-73218924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73097194 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 347 (V347A)
Ref Sequence ENSEMBL: ENSMUSP00000028517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028517] [ENSMUST00000112055]
Predicted Effect probably damaging
Transcript: ENSMUST00000028517
AA Change: V347A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028517
Gene: ENSMUSG00000027108
AA Change: V347A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:FeoB_N 23 74 2.2e-8 PFAM
Pfam:MMR_HSR1 24 164 1.2e-22 PFAM
Pfam:YchF-GTPase_C 305 388 9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112055
SMART Domains Protein: ENSMUSP00000107686
Gene: ENSMUSG00000027108

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:FeoB_N 23 74 1.5e-7 PFAM
Pfam:MMR_HSR1 24 259 3.2e-18 PFAM
low complexity region 261 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152608
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase protein family. The encoded protein interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. Overexpression of this gene has been observed in multiple types of cancer and may be associated with poor survival. Pseudogenes of this gene have been defined on chromosomes 17 and 22. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null allele display partial neonatal lethality, embryonic developmental delay, delayed development of lung and liver, and reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Ola1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ola1 APN 2 73156897 missense probably benign 0.00
IGL01969:Ola1 APN 2 73100146 missense probably benign 0.01
IGL02605:Ola1 APN 2 73142300 splice site probably benign
IGL02987:Ola1 APN 2 73156898 missense probably benign 0.03
IGL03171:Ola1 APN 2 73156853 missense probably benign 0.24
R0602:Ola1 UTSW 2 73093712 missense probably damaging 1.00
R1474:Ola1 UTSW 2 73156844 missense probably damaging 1.00
R1650:Ola1 UTSW 2 73156894 missense possibly damaging 0.65
R1781:Ola1 UTSW 2 73156755 missense possibly damaging 0.92
R3732:Ola1 UTSW 2 73156860 missense probably damaging 1.00
R3732:Ola1 UTSW 2 73156860 missense probably damaging 1.00
R3733:Ola1 UTSW 2 73156860 missense probably damaging 1.00
R3918:Ola1 UTSW 2 73142339 missense probably benign 0.33
R4650:Ola1 UTSW 2 73141965 missense probably damaging 1.00
R5304:Ola1 UTSW 2 73199434 missense probably damaging 0.99
R5352:Ola1 UTSW 2 73099330 missense probably damaging 0.99
R5918:Ola1 UTSW 2 73156784 missense probably benign 0.18
R6062:Ola1 UTSW 2 73199498 missense probably damaging 1.00
R6858:Ola1 UTSW 2 73097230 missense probably damaging 0.97
R7077:Ola1 UTSW 2 73141964 missense probably damaging 1.00
R8223:Ola1 UTSW 2 73099350 missense probably damaging 1.00
R8343:Ola1 UTSW 2 73199401 missense probably damaging 0.99
Predicted Primers
Posted On2014-01-15