Mutagenetix > Incidental Mutations

Incidental Mutation 'R1167:Olfr1037'

101076

Institutional Source

Beutler Lab

Gene Symbol

Olfr1037

Ensembl Gene

ENSMUSG00000075205

Gene Name

olfactory receptor 1037

Synonyms

MOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775

MMRRC Submission

039240-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86084671-86087385 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86085291 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 162 (V162A)

Ref Sequence

ENSEMBL: ENSMUSP00000150319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]

Predicted Effect

probably benign
Transcript: ENSMUST00000099911
AA Change: V162A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: V162A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.8e-54	PFAM
Pfam:7tm_1	41	290	1.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213333
AA Change: V162A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000216020
AA Change: V162A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000216886
AA Change: V162A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Olfr1037

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Olfr1037	APN	2	86085640	missense	probably benign	0.05
IGL02534:Olfr1037	APN	2	86085369	missense	probably damaging	1.00
IGL03204:Olfr1037	APN	2	86085671	nonsense	probably null
R0054:Olfr1037	UTSW	2	86085361	missense	probably benign	0.38
R0054:Olfr1037	UTSW	2	86085361	missense	probably benign	0.38
R0131:Olfr1037	UTSW	2	86085500	missense	probably damaging	1.00
R0131:Olfr1037	UTSW	2	86085500	missense	probably damaging	1.00
R0666:Olfr1037	UTSW	2	86085213	missense	probably benign	0.03
R0732:Olfr1037	UTSW	2	86085584	missense	probably benign	0.00
R1899:Olfr1037	UTSW	2	86085720	missense	probably benign
R3082:Olfr1037	UTSW	2	86085709	missense	probably benign
R3847:Olfr1037	UTSW	2	86085407	nonsense	probably null
R3848:Olfr1037	UTSW	2	86085407	nonsense	probably null
R4079:Olfr1037	UTSW	2	86085312	missense	possibly damaging	0.67
R4193:Olfr1037	UTSW	2	86085700	missense	probably benign	0.01
R4832:Olfr1037	UTSW	2	86084846	missense	probably benign	0.00
R5244:Olfr1037	UTSW	2	86084956	missense	probably damaging	1.00
R5643:Olfr1037	UTSW	2	86085159	missense	probably damaging	0.98
R5644:Olfr1037	UTSW	2	86085159	missense	probably damaging	0.98
R5974:Olfr1037	UTSW	2	86084881	missense	probably benign
R6136:Olfr1037	UTSW	2	86084901	missense	probably damaging	1.00
R6189:Olfr1037	UTSW	2	86084913	missense	possibly damaging	0.53
R6483:Olfr1037	UTSW	2	86085440	missense	probably benign	0.00
R6569:Olfr1037	UTSW	2	86085505	missense	possibly damaging	0.87
R6724:Olfr1037	UTSW	2	86085357	missense	possibly damaging	0.81
R6867:Olfr1037	UTSW	2	86085738	missense	possibly damaging	0.59
R7081:Olfr1037	UTSW	2	86085595	missense	probably damaging	1.00
R7207:Olfr1037	UTSW	2	86084815	missense	possibly damaging	0.93
R7436:Olfr1037	UTSW	2	86084907	missense	probably damaging	1.00
R8699:Olfr1037	UTSW	2	86085174	missense	probably damaging	0.98
X0062:Olfr1037	UTSW	2	86085114	missense	probably damaging	1.00
Z1088:Olfr1037	UTSW	2	86084982	missense	probably benign	0.00

Predicted Primers

Posted On

2014-01-15