Incidental Mutation 'R1195:Brd1'
ID101079
Institutional Source Beutler Lab
Gene Symbol Brd1
Ensembl Gene ENSMUSG00000022387
Gene Namebromodomain containing 1
Synonyms1110059H06Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88687034-88734233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88700811 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 940 (E940G)
Ref Sequence ENSEMBL: ENSMUSP00000105007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088911] [ENSMUST00000109380] [ENSMUST00000109381]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088911
SMART Domains Protein: ENSMUSP00000086300
Gene: ENSMUSG00000022387

DomainStartEndE-ValueType
Pfam:EPL1 46 196 1.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109380
AA Change: E809G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387
AA Change: E809G

DomainStartEndE-ValueType
Pfam:EPL1 46 196 3.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 836 869 N/A INTRINSIC
PWWP 927 1010 2.25e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109381
AA Change: E940G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387
AA Change: E940G

DomainStartEndE-ValueType
Pfam:EPL1 47 196 3.9e-37 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 857 876 N/A INTRINSIC
low complexity region 887 898 N/A INTRINSIC
low complexity region 967 1000 N/A INTRINSIC
PWWP 1058 1141 2.25e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150004
Meta Mutation Damage Score 0.0952 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Brd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd1 APN 15 88730158 missense probably benign 0.38
IGL00924:Brd1 APN 15 88729409 missense possibly damaging 0.80
IGL01626:Brd1 APN 15 88700887 missense probably damaging 1.00
IGL02569:Brd1 APN 15 88713929 missense probably damaging 1.00
IGL02646:Brd1 APN 15 88700877 missense probably damaging 1.00
IGL03130:Brd1 APN 15 88688374 missense probably benign
IGL03343:Brd1 APN 15 88707251 missense possibly damaging 0.89
spry UTSW 15 88688355 missense possibly damaging 0.47
R0089:Brd1 UTSW 15 88701198 missense probably benign 0.06
R0112:Brd1 UTSW 15 88730383 missense probably benign
R0165:Brd1 UTSW 15 88729777 missense probably damaging 0.99
R0965:Brd1 UTSW 15 88717028 missense probably damaging 1.00
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1534:Brd1 UTSW 15 88689663 missense possibly damaging 0.68
R2245:Brd1 UTSW 15 88689860 critical splice donor site probably null
R3611:Brd1 UTSW 15 88700944 missense probably benign
R3751:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3752:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3753:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3801:Brd1 UTSW 15 88717040 missense probably damaging 1.00
R4956:Brd1 UTSW 15 88730113 missense probably damaging 1.00
R5382:Brd1 UTSW 15 88729564 missense probably damaging 1.00
R5546:Brd1 UTSW 15 88701122 missense probably benign 0.00
R5659:Brd1 UTSW 15 88713381 missense probably benign 0.14
R5730:Brd1 UTSW 15 88717045 missense probably benign 0.05
R5773:Brd1 UTSW 15 88689549 missense probably benign 0.14
R6224:Brd1 UTSW 15 88688355 missense possibly damaging 0.47
R6371:Brd1 UTSW 15 88713998 missense probably benign
R7096:Brd1 UTSW 15 88713935 missense probably damaging 1.00
R7722:Brd1 UTSW 15 88729559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTAGCAGTGGAAACAGCCTC -3'
(R):5'- CTGCAAATCGAAAAGTGTAAGCCCC -3'

Sequencing Primer
(F):5'- TTTACCCACAAGATAAGGAGTGC -3'
(R):5'- TGTAAGCCCCCCAAAGTCTG -3'
Posted On2014-01-15