Incidental Mutation 'R1167:Adnp'
ID 101080
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Name activity-dependent neuroprotective protein
Synonyms mKIAA0784
MMRRC Submission 039240-MU
Accession Numbers

Genbank: NM_009628; MGI: 1338758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 168180986-168207112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 168184500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 292 (S292P)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
AlphaFold Q9Z103
Predicted Effect probably benign
Transcript: ENSMUST00000057793
AA Change: S292P

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: S292P

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088001
AA Change: S292P

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: S292P

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168182562 missense probably benign
IGL00500:Adnp APN 2 168183323 missense possibly damaging 0.85
IGL01604:Adnp APN 2 168184338 missense probably damaging 0.99
IGL01967:Adnp APN 2 168183419 missense possibly damaging 0.85
IGL02470:Adnp APN 2 168183194 missense probably damaging 0.99
C9142:Adnp UTSW 2 168184407 missense probably damaging 0.99
R0893:Adnp UTSW 2 168183727 missense possibly damaging 0.85
R1182:Adnp UTSW 2 168184796 missense possibly damaging 0.77
R1480:Adnp UTSW 2 168183534 missense probably damaging 0.99
R1505:Adnp UTSW 2 168183741 missense possibly damaging 0.93
R1906:Adnp UTSW 2 168182367 missense probably benign
R3711:Adnp UTSW 2 168184823 missense probably damaging 0.98
R3943:Adnp UTSW 2 168185060 missense possibly damaging 0.92
R4440:Adnp UTSW 2 168184801 missense possibly damaging 0.92
R4686:Adnp UTSW 2 168182389 missense possibly damaging 0.78
R4916:Adnp UTSW 2 168187617 missense possibly damaging 0.91
R5072:Adnp UTSW 2 168183001 missense probably damaging 0.96
R5312:Adnp UTSW 2 168184188 missense probably benign
R5393:Adnp UTSW 2 168182949 missense possibly damaging 0.95
R5598:Adnp UTSW 2 168183725 missense probably damaging 0.99
R6230:Adnp UTSW 2 168182532 missense probably benign
R7165:Adnp UTSW 2 168182367 missense probably benign 0.07
R7176:Adnp UTSW 2 168182658 missense probably benign
R7238:Adnp UTSW 2 168183967 missense probably damaging 1.00
R7254:Adnp UTSW 2 168183998 missense probably damaging 0.99
R7581:Adnp UTSW 2 168183466 missense probably damaging 0.96
R7676:Adnp UTSW 2 168183447 nonsense probably null
R7863:Adnp UTSW 2 168189350 missense possibly damaging 0.91
R8098:Adnp UTSW 2 168182532 missense probably benign
R8196:Adnp UTSW 2 168183172 missense probably benign
R8970:Adnp UTSW 2 168189370 missense possibly damaging 0.91
R9153:Adnp UTSW 2 168184660 missense possibly damaging 0.96
R9154:Adnp UTSW 2 168184660 missense possibly damaging 0.96
R9228:Adnp UTSW 2 168184878 missense probably damaging 0.98
R9256:Adnp UTSW 2 168184025 missense probably damaging 1.00
R9268:Adnp UTSW 2 168189313 missense possibly damaging 0.86
R9434:Adnp UTSW 2 168184457 missense probably damaging 0.99
R9517:Adnp UTSW 2 168182946 missense possibly damaging 0.93
R9621:Adnp UTSW 2 168182743 missense probably benign 0.22
R9669:Adnp UTSW 2 168184998 missense possibly damaging 0.91
R9737:Adnp UTSW 2 168184998 missense possibly damaging 0.91
Predicted Primers
Posted On 2014-01-15