Incidental Mutation 'R1195:Sema5b'
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
SynonymsSemG, Semag, SemG
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1195 (G1)
Quality Score126
Status Not validated
Chromosomal Location35541145-35664732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35651660 bp
Amino Acid Change Glutamic Acid to Valine at position 496 (E496V)
Ref Sequence ENSEMBL: ENSMUSP00000112536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
Predicted Effect probably null
Transcript: ENSMUST00000050625
AA Change: E496V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133
AA Change: E496V

signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120756
AA Change: E496V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133
AA Change: E496V

signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133554
Meta Mutation Damage Score 0.1953 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Ighv10-1 A T 12: 114,479,395 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35651315 missense probably damaging 1.00
IGL01584:Sema5b APN 16 35645423 missense probably damaging 1.00
IGL01859:Sema5b APN 16 35647109 missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35660479 critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35649755 missense probably damaging 1.00
IGL02850:Sema5b APN 16 35660515 missense probably benign 0.01
IGL03277:Sema5b APN 16 35651312 missense probably damaging 0.96
R0101:Sema5b UTSW 16 35663102 splice site probably benign
R0368:Sema5b UTSW 16 35628100 missense probably damaging 1.00
R0426:Sema5b UTSW 16 35646355 missense probably damaging 1.00
R0675:Sema5b UTSW 16 35660333 missense probably benign 0.00
R0905:Sema5b UTSW 16 35622631 missense probably benign 0.33
R1163:Sema5b UTSW 16 35628096 missense probably benign 0.19
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1666:Sema5b UTSW 16 35658482 missense probably benign 0.03
R1706:Sema5b UTSW 16 35649755 missense probably damaging 0.98
R1733:Sema5b UTSW 16 35646367 missense probably damaging 1.00
R1775:Sema5b UTSW 16 35660324 missense probably benign
R2215:Sema5b UTSW 16 35660215 missense probably damaging 1.00
R2844:Sema5b UTSW 16 35659931 missense probably damaging 0.98
R3086:Sema5b UTSW 16 35622723 missense probably benign
R3613:Sema5b UTSW 16 35660150 missense probably benign
R4774:Sema5b UTSW 16 35663182 missense probably damaging 1.00
R5743:Sema5b UTSW 16 35658476 missense probably damaging 1.00
R5856:Sema5b UTSW 16 35646386 nonsense probably null
R5993:Sema5b UTSW 16 35646202 missense probably damaging 1.00
R6248:Sema5b UTSW 16 35628007 splice site probably null
R6420:Sema5b UTSW 16 35663146 missense probably benign 0.08
R6795:Sema5b UTSW 16 35658571 nonsense probably null
R6825:Sema5b UTSW 16 35628007 splice site probably null
R7066:Sema5b UTSW 16 35651312 missense probably benign 0.26
R7244:Sema5b UTSW 16 35660545 missense probably benign
R7446:Sema5b UTSW 16 35647203 missense probably damaging 1.00
R7497:Sema5b UTSW 16 35661330 missense probably damaging 1.00
R7516:Sema5b UTSW 16 35651170 missense probably benign 0.05
R7878:Sema5b UTSW 16 35661626 missense probably benign 0.00
R7922:Sema5b UTSW 16 35658256 frame shift probably null
R8397:Sema5b UTSW 16 35651321 missense possibly damaging 0.59
R8537:Sema5b UTSW 16 35651609 missense possibly damaging 0.49
Z1088:Sema5b UTSW 16 35660590 missense probably damaging 0.99
Z1176:Sema5b UTSW 16 35628018 missense probably benign 0.01
Z1176:Sema5b UTSW 16 35646273 missense probably benign 0.05
Z1176:Sema5b UTSW 16 35649864 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- TCCTTTGTccccccccc -3'
(R):5'- tgcagaggttaagtgacttatcc -3'
Posted On2014-01-15