Incidental Mutation 'R1167:Steap4'
ID101092
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene NameSTEAP family member 4
SynonymsTiarp, Tnfaip9
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location7960457-7982213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7976520 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 161 (K161T)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
Predicted Effect probably benign
Transcript: ENSMUST00000115421
AA Change: K161T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: K161T

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
R8861:Steap4 UTSW 5 7975672 missense probably benign 0.00
Predicted Primers
Posted On2014-01-15