Incidental Mutation 'R1167:Vmn2r8'
ID 101100
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Name vomeronasal 2, receptor 8
Synonyms EG627479
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 108945059-108956620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108951042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 134 (L134F)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
AlphaFold L7N472
Predicted Effect probably benign
Transcript: ENSMUST00000172140
AA Change: L134F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: L134F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108,950,091 (GRCm39) missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108,945,807 (GRCm39) splice site probably null
R0335:Vmn2r8 UTSW 5 108,945,317 (GRCm39) splice site probably null
R0394:Vmn2r8 UTSW 5 108,949,938 (GRCm39) missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108,951,049 (GRCm39) missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108,947,195 (GRCm39) missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108,948,412 (GRCm39) missense probably benign 0.00
R1187:Vmn2r8 UTSW 5 108,951,085 (GRCm39) nonsense probably null
R1406:Vmn2r8 UTSW 5 108,950,234 (GRCm39) missense probably benign
R1406:Vmn2r8 UTSW 5 108,950,234 (GRCm39) missense probably benign
R1451:Vmn2r8 UTSW 5 108,945,933 (GRCm39) missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108,950,040 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108,950,972 (GRCm39) missense probably benign
R1874:Vmn2r8 UTSW 5 108,950,284 (GRCm39) missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108,945,436 (GRCm39) missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108,950,019 (GRCm39) missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108,947,152 (GRCm39) missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108,945,961 (GRCm39) missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108,950,249 (GRCm39) missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108,956,487 (GRCm39) missense possibly damaging 0.94
R2159:Vmn2r8 UTSW 5 108,950,169 (GRCm39) missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108,945,369 (GRCm39) missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108,949,570 (GRCm39) missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108,956,447 (GRCm39) missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108,949,566 (GRCm39) missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108,945,264 (GRCm39) missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108,947,129 (GRCm39) missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108,956,572 (GRCm39) missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108,949,636 (GRCm39) missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108,950,106 (GRCm39) missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108,950,325 (GRCm39) missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108,945,248 (GRCm39) missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108,947,211 (GRCm39) missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108,956,463 (GRCm39) missense probably benign
R6315:Vmn2r8 UTSW 5 108,949,757 (GRCm39) missense probably benign
R6413:Vmn2r8 UTSW 5 108,949,589 (GRCm39) missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108,956,504 (GRCm39) missense possibly damaging 0.56
R7406:Vmn2r8 UTSW 5 108,948,442 (GRCm39) missense probably benign 0.00
R7409:Vmn2r8 UTSW 5 108,956,449 (GRCm39) nonsense probably null
R7489:Vmn2r8 UTSW 5 108,945,522 (GRCm39) missense possibly damaging 0.95
R7532:Vmn2r8 UTSW 5 108,950,106 (GRCm39) missense probably benign 0.22
R7534:Vmn2r8 UTSW 5 108,950,040 (GRCm39) missense possibly damaging 0.94
R7739:Vmn2r8 UTSW 5 108,950,043 (GRCm39) missense probably damaging 1.00
R8099:Vmn2r8 UTSW 5 108,949,700 (GRCm39) missense probably benign
R8245:Vmn2r8 UTSW 5 108,945,936 (GRCm39) missense probably damaging 1.00
R8711:Vmn2r8 UTSW 5 108,945,962 (GRCm39) missense possibly damaging 0.89
R8781:Vmn2r8 UTSW 5 108,945,597 (GRCm39) missense possibly damaging 0.95
R8874:Vmn2r8 UTSW 5 108,956,617 (GRCm39) missense probably damaging 1.00
R8927:Vmn2r8 UTSW 5 108,950,131 (GRCm39) missense
R8928:Vmn2r8 UTSW 5 108,950,131 (GRCm39) missense
R9288:Vmn2r8 UTSW 5 108,950,185 (GRCm39) missense probably benign 0.39
R9596:Vmn2r8 UTSW 5 108,947,196 (GRCm39) missense possibly damaging 0.94
R9652:Vmn2r8 UTSW 5 108,951,107 (GRCm39) missense probably benign 0.18
Z1088:Vmn2r8 UTSW 5 108,949,864 (GRCm39) missense probably damaging 0.99
Predicted Primers
Posted On 2014-01-15