Incidental Mutation 'R1196:Pank4'
ID101103
Institutional Source Beutler Lab
Gene Symbol Pank4
Ensembl Gene ENSMUSG00000029056
Gene Namepantothenate kinase 4
SynonymsD030031I12Rik
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1196 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154964123-154980938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154978173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 584 (F584L)
Ref Sequence ENSEMBL: ENSMUSP00000064330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030931] [ENSMUST00000070953] [ENSMUST00000105631]
Predicted Effect probably damaging
Transcript: ENSMUST00000030931
AA Change: F584L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030931
Gene: ENSMUSG00000029056
AA Change: F584L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 35 369 1.5e-142 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 763 1.4e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070953
AA Change: F584L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064330
Gene: ENSMUSG00000029056
AA Change: F584L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Fumble 36 367 1.8e-133 PFAM
low complexity region 415 428 N/A INTRINSIC
Pfam:DUF89 451 810 3.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105631
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148299
Predicted Effect unknown
Transcript: ENSMUST00000148934
AA Change: F441L
SMART Domains Protein: ENSMUSP00000125663
Gene: ENSMUSG00000029056
AA Change: F441L

DomainStartEndE-ValueType
Pfam:Fumble 1 225 2.6e-103 PFAM
low complexity region 273 286 N/A INTRINSIC
Pfam:DUF89 309 472 1.9e-30 PFAM
Meta Mutation Damage Score 0.1860 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Pank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Pank4 APN 4 154980602 missense possibly damaging 0.50
IGL01105:Pank4 APN 4 154972465 splice site probably benign
IGL01291:Pank4 APN 4 154974646 missense probably damaging 0.98
IGL01935:Pank4 APN 4 154979530 missense probably damaging 1.00
IGL02366:Pank4 APN 4 154969628 missense probably benign 0.03
IGL02514:Pank4 APN 4 154970465 missense probably damaging 0.99
IGL03028:Pank4 APN 4 154969985 unclassified probably benign
IGL03033:Pank4 APN 4 154974715 missense probably damaging 1.00
ANU05:Pank4 UTSW 4 154974646 missense probably damaging 0.98
R0518:Pank4 UTSW 4 154976625 missense possibly damaging 0.90
R1566:Pank4 UTSW 4 154980521 missense probably damaging 0.98
R1581:Pank4 UTSW 4 154974651 missense probably damaging 1.00
R1709:Pank4 UTSW 4 154970047 missense probably damaging 1.00
R1852:Pank4 UTSW 4 154976359 missense probably damaging 1.00
R1950:Pank4 UTSW 4 154972520 missense probably benign
R2943:Pank4 UTSW 4 154971474 missense probably benign 0.01
R3911:Pank4 UTSW 4 154969601 missense probably damaging 1.00
R4162:Pank4 UTSW 4 154979594 critical splice donor site probably null
R4404:Pank4 UTSW 4 154980156 missense probably benign 0.00
R4619:Pank4 UTSW 4 154976619 missense probably benign 0.07
R4731:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4732:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4733:Pank4 UTSW 4 154971390 missense probably benign 0.01
R4747:Pank4 UTSW 4 154979532 missense probably damaging 1.00
R4760:Pank4 UTSW 4 154974634 missense possibly damaging 0.60
R5218:Pank4 UTSW 4 154979728 missense probably benign 0.01
R5278:Pank4 UTSW 4 154972165 missense probably damaging 1.00
R5774:Pank4 UTSW 4 154980662 missense probably damaging 1.00
R6004:Pank4 UTSW 4 154977221 missense probably damaging 1.00
R6376:Pank4 UTSW 4 154972236 splice site probably null
R7105:Pank4 UTSW 4 154980167 missense probably benign 0.07
R7253:Pank4 UTSW 4 154970920 missense probably benign 0.02
R7481:Pank4 UTSW 4 154970038 missense probably damaging 1.00
R7565:Pank4 UTSW 4 154980550 missense probably benign 0.08
R7718:Pank4 UTSW 4 154974643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGGGTTGTTCACTCTCCTG -3'
(R):5'- GGGGCTTGTTTCACCAAGGCTATC -3'

Sequencing Primer
(F):5'- AGGTCTGAGCTTTAACGCTATACTG -3'
(R):5'- GTTTCACCAAGGCTATCTCATC -3'
Posted On2014-01-15