Incidental Mutation 'R1167:Cyp26b1'
ID 101106
Institutional Source Beutler Lab
Gene Symbol Cyp26b1
Ensembl Gene ENSMUSG00000063415
Gene Name cytochrome P450, family 26, subfamily b, polypeptide 1
Synonyms P450RAI-2, CP26, retinoic acid B1
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 84571414-84593908 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84584330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 117 (W117R)
Ref Sequence ENSEMBL: ENSMUSP00000145092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077705] [ENSMUST00000168003] [ENSMUST00000204109] [ENSMUST00000204146] [ENSMUST00000205228]
AlphaFold Q811W2
Predicted Effect probably damaging
Transcript: ENSMUST00000077705
AA Change: W117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076886
Gene: ENSMUSG00000063415
AA Change: W117R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168003
AA Change: W117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128391
Gene: ENSMUSG00000063415
AA Change: W117R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204109
SMART Domains Protein: ENSMUSP00000144998
Gene: ENSMUSG00000063415

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 65 415 5.8e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204146
AA Change: W117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145092
Gene: ENSMUSG00000063415
AA Change: W117R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205228
SMART Domains Protein: ENSMUSP00000144836
Gene: ENSMUSG00000063415

DomainStartEndE-ValueType
Pfam:p450 13 299 5.9e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Limb morphogenesis and proximal-distal patterning is disrupted in homozygous null fetuses. Mutant mice are born, however they die immediately after birth exhibiting respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Cyp26b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Cyp26b1 APN 6 84574301 missense probably benign 0.00
IGL02530:Cyp26b1 APN 6 84574312 missense possibly damaging 0.95
IGL02624:Cyp26b1 APN 6 84584339 missense probably benign 0.00
IGL02676:Cyp26b1 APN 6 84576644 missense probably damaging 1.00
R0125:Cyp26b1 UTSW 6 84574515 missense probably damaging 1.00
R0127:Cyp26b1 UTSW 6 84577208 splice site probably benign
R0268:Cyp26b1 UTSW 6 84574572 missense probably damaging 1.00
R0281:Cyp26b1 UTSW 6 84574556 missense probably damaging 1.00
R0575:Cyp26b1 UTSW 6 84575306 splice site probably benign
R1171:Cyp26b1 UTSW 6 84576671 missense possibly damaging 0.64
R1512:Cyp26b1 UTSW 6 84576997 missense probably benign 0.16
R1791:Cyp26b1 UTSW 6 84584459 missense probably benign 0.05
R1799:Cyp26b1 UTSW 6 84584272 missense probably benign 0.37
R2065:Cyp26b1 UTSW 6 84576555 missense probably benign 0.00
R2103:Cyp26b1 UTSW 6 84575050 missense possibly damaging 0.67
R2900:Cyp26b1 UTSW 6 84576641 missense possibly damaging 0.70
R4510:Cyp26b1 UTSW 6 84574491 missense probably damaging 1.00
R4511:Cyp26b1 UTSW 6 84574491 missense probably damaging 1.00
R4934:Cyp26b1 UTSW 6 84576972 missense possibly damaging 0.65
R5585:Cyp26b1 UTSW 6 84577189 missense probably damaging 0.99
R7229:Cyp26b1 UTSW 6 84577150 nonsense probably null
R7497:Cyp26b1 UTSW 6 84576982 missense possibly damaging 0.55
R7672:Cyp26b1 UTSW 6 84584369 missense probably benign 0.04
R8346:Cyp26b1 UTSW 6 84577168 missense probably benign 0.21
R9020:Cyp26b1 UTSW 6 84575074 missense probably benign 0.09
R9029:Cyp26b1 UTSW 6 84577053 missense probably benign 0.20
R9042:Cyp26b1 UTSW 6 84576608 missense probably benign 0.18
R9068:Cyp26b1 UTSW 6 84574397 missense probably damaging 0.96
R9536:Cyp26b1 UTSW 6 84577017 missense probably benign 0.02
R9779:Cyp26b1 UTSW 6 84575131 missense probably benign
X0063:Cyp26b1 UTSW 6 84575118 missense probably benign 0.00
Z1176:Cyp26b1 UTSW 6 84577114 missense probably benign 0.01
Z1177:Cyp26b1 UTSW 6 84577119 missense probably damaging 1.00
Predicted Primers
Posted On 2014-01-15