Incidental Mutation 'R1167:Cyp26b1'
ID 101106
Institutional Source Beutler Lab
Gene Symbol Cyp26b1
Ensembl Gene ENSMUSG00000063415
Gene Name cytochrome P450, family 26, subfamily b, polypeptide 1
Synonyms retinoic acid B1, CP26, P450RAI-2
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 84548396-84570890 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84561312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 117 (W117R)
Ref Sequence ENSEMBL: ENSMUSP00000145092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077705] [ENSMUST00000168003] [ENSMUST00000204109] [ENSMUST00000204146] [ENSMUST00000205228]
AlphaFold Q811W2
Predicted Effect probably damaging
Transcript: ENSMUST00000077705
AA Change: W117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076886
Gene: ENSMUSG00000063415
AA Change: W117R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168003
AA Change: W117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128391
Gene: ENSMUSG00000063415
AA Change: W117R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204109
SMART Domains Protein: ENSMUSP00000144998
Gene: ENSMUSG00000063415

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 65 415 5.8e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204146
AA Change: W117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145092
Gene: ENSMUSG00000063415
AA Change: W117R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205228
SMART Domains Protein: ENSMUSP00000144836
Gene: ENSMUSG00000063415

DomainStartEndE-ValueType
Pfam:p450 13 299 5.9e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Limb morphogenesis and proximal-distal patterning is disrupted in homozygous null fetuses. Mutant mice are born, however they die immediately after birth exhibiting respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Cyp26b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Cyp26b1 APN 6 84,551,283 (GRCm39) missense probably benign 0.00
IGL02530:Cyp26b1 APN 6 84,551,294 (GRCm39) missense possibly damaging 0.95
IGL02624:Cyp26b1 APN 6 84,561,321 (GRCm39) missense probably benign 0.00
IGL02676:Cyp26b1 APN 6 84,553,626 (GRCm39) missense probably damaging 1.00
R0125:Cyp26b1 UTSW 6 84,551,497 (GRCm39) missense probably damaging 1.00
R0127:Cyp26b1 UTSW 6 84,554,190 (GRCm39) splice site probably benign
R0268:Cyp26b1 UTSW 6 84,551,554 (GRCm39) missense probably damaging 1.00
R0281:Cyp26b1 UTSW 6 84,551,538 (GRCm39) missense probably damaging 1.00
R0575:Cyp26b1 UTSW 6 84,552,288 (GRCm39) splice site probably benign
R1171:Cyp26b1 UTSW 6 84,553,653 (GRCm39) missense possibly damaging 0.64
R1512:Cyp26b1 UTSW 6 84,553,979 (GRCm39) missense probably benign 0.16
R1791:Cyp26b1 UTSW 6 84,561,441 (GRCm39) missense probably benign 0.05
R1799:Cyp26b1 UTSW 6 84,561,254 (GRCm39) missense probably benign 0.37
R2065:Cyp26b1 UTSW 6 84,553,537 (GRCm39) missense probably benign 0.00
R2103:Cyp26b1 UTSW 6 84,552,032 (GRCm39) missense possibly damaging 0.67
R2900:Cyp26b1 UTSW 6 84,553,623 (GRCm39) missense possibly damaging 0.70
R4510:Cyp26b1 UTSW 6 84,551,473 (GRCm39) missense probably damaging 1.00
R4511:Cyp26b1 UTSW 6 84,551,473 (GRCm39) missense probably damaging 1.00
R4934:Cyp26b1 UTSW 6 84,553,954 (GRCm39) missense possibly damaging 0.65
R5585:Cyp26b1 UTSW 6 84,554,171 (GRCm39) missense probably damaging 0.99
R7229:Cyp26b1 UTSW 6 84,554,132 (GRCm39) nonsense probably null
R7497:Cyp26b1 UTSW 6 84,553,964 (GRCm39) missense possibly damaging 0.55
R7672:Cyp26b1 UTSW 6 84,561,351 (GRCm39) missense probably benign 0.04
R8346:Cyp26b1 UTSW 6 84,554,150 (GRCm39) missense probably benign 0.21
R9020:Cyp26b1 UTSW 6 84,552,056 (GRCm39) missense probably benign 0.09
R9029:Cyp26b1 UTSW 6 84,554,035 (GRCm39) missense probably benign 0.20
R9042:Cyp26b1 UTSW 6 84,553,590 (GRCm39) missense probably benign 0.18
R9068:Cyp26b1 UTSW 6 84,551,379 (GRCm39) missense probably damaging 0.96
R9536:Cyp26b1 UTSW 6 84,553,999 (GRCm39) missense probably benign 0.02
R9779:Cyp26b1 UTSW 6 84,552,113 (GRCm39) missense probably benign
X0063:Cyp26b1 UTSW 6 84,552,100 (GRCm39) missense probably benign 0.00
Z1176:Cyp26b1 UTSW 6 84,554,096 (GRCm39) missense probably benign 0.01
Z1177:Cyp26b1 UTSW 6 84,554,101 (GRCm39) missense probably damaging 1.00
Predicted Primers
Posted On 2014-01-15