Incidental Mutation 'R1167:Rho'
ID 101108
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Name rhodopsin
Synonyms opsin 2, Noerg1, Rod Opsin, Long Wavelength Sensitive opsin, LWS opsin, L opsin, Red Opsin, Ops, RP4, Opn2
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1167 (G1)
Quality Score 173
Status Not validated
Chromosome 6
Chromosomal Location 115908709-115916997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115912384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 100 (T100A)
Ref Sequence ENSEMBL: ENSMUSP00000144768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]
AlphaFold P15409
Predicted Effect probably damaging
Transcript: ENSMUST00000032471
AA Change: T242A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: T242A

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203531
Predicted Effect probably damaging
Transcript: ENSMUST00000203877
AA Change: T83A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324
AA Change: T83A

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203894
Predicted Effect silent
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204711
AA Change: T100A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324
AA Change: T100A

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115,909,146 (GRCm39) missense probably damaging 0.99
IGL02480:Rho APN 6 115,912,505 (GRCm39) missense probably benign 0.20
IGL02625:Rho APN 6 115,912,158 (GRCm39) missense possibly damaging 0.95
bemr3 UTSW 6 115,912,092 (GRCm39) missense probably damaging 1.00
R0165:Rho UTSW 6 115,909,188 (GRCm39) missense probably damaging 1.00
R1169:Rho UTSW 6 115,909,199 (GRCm39) missense probably damaging 1.00
R1312:Rho UTSW 6 115,912,566 (GRCm39) missense probably damaging 1.00
R2393:Rho UTSW 6 115,912,352 (GRCm39) splice site probably benign
R3895:Rho UTSW 6 115,910,863 (GRCm39) missense probably damaging 1.00
R4414:Rho UTSW 6 115,912,191 (GRCm39) missense probably benign
R4416:Rho UTSW 6 115,912,191 (GRCm39) missense probably benign
R5753:Rho UTSW 6 115,912,448 (GRCm39) missense probably damaging 1.00
R6483:Rho UTSW 6 115,909,218 (GRCm39) missense possibly damaging 0.78
R6552:Rho UTSW 6 115,908,709 (GRCm39) splice site probably null
R6719:Rho UTSW 6 115,910,854 (GRCm39) missense possibly damaging 0.58
R7030:Rho UTSW 6 115,912,504 (GRCm39) missense possibly damaging 0.93
R7354:Rho UTSW 6 115,912,464 (GRCm39) nonsense probably null
R7566:Rho UTSW 6 115,909,135 (GRCm39) missense probably damaging 1.00
R7674:Rho UTSW 6 115,909,294 (GRCm39) missense probably damaging 1.00
R7699:Rho UTSW 6 115,912,200 (GRCm39) missense probably damaging 0.98
R7700:Rho UTSW 6 115,912,200 (GRCm39) missense probably damaging 0.98
R8477:Rho UTSW 6 115,912,346 (GRCm39) splice site probably null
R8745:Rho UTSW 6 115,912,483 (GRCm39) missense probably damaging 1.00
R9783:Rho UTSW 6 115,910,920 (GRCm39) missense probably benign 0.01
Predicted Primers
Posted On 2014-01-15