Incidental Mutation 'R1196:D6Ertd527e'
ID 101113
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock # R1196 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 87104746-87112997 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 87111524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 223 (T223S)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: T222S
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203725
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: T222S
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: T223S
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: T223S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205257
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Jmjd1c T C 10: 67,239,236 probably benign Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
R0739_D6Ertd527e_618 UTSW 6 87111668 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
R8047:D6Ertd527e UTSW 6 87111472 missense unknown
R8827:D6Ertd527e UTSW 6 87111244 missense unknown
R9038:D6Ertd527e UTSW 6 87112251 makesense probably null
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATCAGACCTAGTAACAGGGGC -3'
(R):5'- GCTGCTGCTACTGCTGCTGC -3'

Sequencing Primer
(F):5'- gcagcatcagcaactatgac -3'
(R):5'- tactgctgctgctgctg -3'
Posted On 2014-01-15