Incidental Mutation 'R1167:Tmem147'
ID101118
Institutional Source Beutler Lab
Gene Symbol Tmem147
Ensembl Gene ENSMUSG00000006315
Gene Nametransmembrane protein 147
Synonyms5033425B17Rik, 2010004E11Rik
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30727701-30729540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30727796 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 146 (V146A)
Ref Sequence ENSEMBL: ENSMUSP00000146893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000074758] [ENSMUST00000170371] [ENSMUST00000182067] [ENSMUST00000182634] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000207779] [ENSMUST00000209065] [ENSMUST00000208169]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006478
AA Change: V220A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315
AA Change: V220A

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074758
SMART Domains Protein: ENSMUSP00000074317
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Gp_dh_N 106 254 6.13e-79 SMART
Pfam:Gp_dh_C 259 416 2.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect probably benign
Transcript: ENSMUST00000170371
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180820
SMART Domains Protein: ENSMUSP00000137757
Gene: ENSMUSG00000097320

DomainStartEndE-ValueType
SCOP:d1i7oa2 53 93 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182067
SMART Domains Protein: ENSMUSP00000138697
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
PDB:2VYV|D 1 44 3e-15 PDB
Blast:Gp_dh_N 4 33 9e-7 BLAST
SCOP:d1cf2o2 9 45 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182634
SMART Domains Protein: ENSMUSP00000138634
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
Gp_dh_N 108 256 6.13e-79 SMART
Pfam:Gp_dh_C 261 418 4.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183194
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably benign
Transcript: ENSMUST00000207296
AA Change: V227A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000207779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207955
Predicted Effect probably benign
Transcript: ENSMUST00000209065
AA Change: V171A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000208169
AA Change: V146A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Tmem147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tmem147 APN 7 30728433 nonsense probably null
IGL02491:Tmem147 APN 7 30728201 splice site probably benign
IGL02971:Tmem147 APN 7 30729422 unclassified probably benign
R0070:Tmem147 UTSW 7 30728101 missense probably damaging 1.00
R0609:Tmem147 UTSW 7 30728102 missense probably benign 0.03
R1254:Tmem147 UTSW 7 30729370 nonsense probably null
R5983:Tmem147 UTSW 7 30728059 missense probably damaging 1.00
R6072:Tmem147 UTSW 7 30728020 missense possibly damaging 0.56
R7636:Tmem147 UTSW 7 30728301 splice site probably null
R7705:Tmem147 UTSW 7 30728291 critical splice acceptor site probably null
R8042:Tmem147 UTSW 7 30728553 missense probably damaging 0.97
R8132:Tmem147 UTSW 7 30728447 missense probably damaging 0.99
R8477:Tmem147 UTSW 7 30728231 missense probably benign 0.00
Predicted Primers
Posted On2014-01-15