Incidental Mutation 'R1167:Gm4884'
ID101124
Institutional Source Beutler Lab
Gene Symbol Gm4884
Ensembl Gene ENSMUSG00000048312
Gene Namepredicted gene 4884
Synonyms
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41032719-41045302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41043912 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 435 (Q435L)
Ref Sequence ENSEMBL: ENSMUSP00000133059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164422
AA Change: Q435L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133059
Gene: ENSMUSG00000048312
AA Change: Q435L

DomainStartEndE-ValueType
Pfam:DUF4629 243 387 8e-62 PFAM
low complexity region 509 533 N/A INTRINSIC
internal_repeat_1 554 584 1.89e-11 PROSPERO
internal_repeat_1 583 613 1.89e-11 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191289
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Gm4884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Gm4884 APN 7 41044385 missense probably benign 0.22
IGL00980:Gm4884 APN 7 41043726 missense probably damaging 1.00
IGL02230:Gm4884 APN 7 41043405 missense probably damaging 1.00
IGL03271:Gm4884 APN 7 41043275 missense probably benign 0.33
IGL03274:Gm4884 APN 7 41044545 missense probably damaging 1.00
R0013:Gm4884 UTSW 7 41044292 missense probably damaging 1.00
R0139:Gm4884 UTSW 7 41042963 missense probably benign 0.00
R0179:Gm4884 UTSW 7 41043828 missense probably benign 0.26
R0960:Gm4884 UTSW 7 41042808 missense possibly damaging 0.55
R1311:Gm4884 UTSW 7 41043115 missense possibly damaging 0.73
R1466:Gm4884 UTSW 7 41043128 missense probably damaging 0.96
R1466:Gm4884 UTSW 7 41043128 missense probably damaging 0.96
R1581:Gm4884 UTSW 7 41043831 missense probably benign 0.09
R1622:Gm4884 UTSW 7 41042841 missense probably damaging 0.99
R1891:Gm4884 UTSW 7 41043115 missense possibly damaging 0.73
R1952:Gm4884 UTSW 7 41044247 missense probably benign 0.02
R2198:Gm4884 UTSW 7 41040805 missense probably benign
R2209:Gm4884 UTSW 7 41043321 missense possibly damaging 0.47
R2210:Gm4884 UTSW 7 41043546 missense possibly damaging 0.72
R2219:Gm4884 UTSW 7 41043486 missense possibly damaging 0.75
R3688:Gm4884 UTSW 7 41043486 missense possibly damaging 0.75
R4437:Gm4884 UTSW 7 41043090 missense probably damaging 0.97
R4472:Gm4884 UTSW 7 41043263 missense probably benign 0.35
R5137:Gm4884 UTSW 7 41042894 missense probably damaging 0.99
R5700:Gm4884 UTSW 7 41043219 missense probably benign 0.22
R5875:Gm4884 UTSW 7 41042936 missense possibly damaging 0.75
R6479:Gm4884 UTSW 7 41040787 missense probably damaging 0.99
R6659:Gm4884 UTSW 7 41044622 missense probably damaging 1.00
R7180:Gm4884 UTSW 7 41044209 missense possibly damaging 0.89
R7844:Gm4884 UTSW 7 41040698 missense probably benign 0.11
R8153:Gm4884 UTSW 7 41043158 missense probably benign 0.17
RF013:Gm4884 UTSW 7 41040809 missense probably damaging 1.00
Z1088:Gm4884 UTSW 7 41042876 missense possibly damaging 0.71
Z1177:Gm4884 UTSW 7 41032737 start gained probably benign
Predicted Primers
Posted On2014-01-15