Incidental Mutation 'R1167:Fes'
ID 101128
Institutional Source Beutler Lab
Gene Symbol Fes
Ensembl Gene ENSMUSG00000053158
Gene Name feline sarcoma oncogene
Synonyms c-fes
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1167 (G1)
Quality Score 185
Status Not validated
Chromosome 7
Chromosomal Location 80377756-80387946 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80383109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 296 (L296Q)
Ref Sequence ENSEMBL: ENSMUSP00000146041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206735] [ENSMUST00000206744]
AlphaFold P16879
Predicted Effect probably damaging
Transcript: ENSMUST00000080932
AA Change: L296Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: L296Q

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205617
AA Change: L296Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206271
Predicted Effect probably benign
Transcript: ENSMUST00000206479
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably benign
Transcript: ENSMUST00000206698
Predicted Effect probably damaging
Transcript: ENSMUST00000206728
AA Change: L296Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206735
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Fes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Fes APN 7 80383273 missense probably benign 0.01
IGL01654:Fes APN 7 80386810 critical splice donor site probably null
IGL02350:Fes APN 7 80383830 splice site probably null
IGL02357:Fes APN 7 80383830 splice site probably null
IGL02811:Fes APN 7 80379841 missense probably damaging 1.00
BB009:Fes UTSW 7 80379872 missense probably damaging 0.99
BB019:Fes UTSW 7 80379872 missense probably damaging 0.99
R0112:Fes UTSW 7 80384005 missense probably damaging 0.99
R0114:Fes UTSW 7 80378035 missense probably damaging 0.99
R0143:Fes UTSW 7 80383895 missense probably benign 0.00
R0786:Fes UTSW 7 80386920 missense probably damaging 1.00
R0863:Fes UTSW 7 80380886 missense probably damaging 1.00
R0918:Fes UTSW 7 80381205 missense probably damaging 1.00
R1174:Fes UTSW 7 80377951 missense probably damaging 1.00
R1674:Fes UTSW 7 80377938 missense probably benign 0.04
R1898:Fes UTSW 7 80379911 missense probably damaging 1.00
R1908:Fes UTSW 7 80386861 missense probably damaging 0.98
R1909:Fes UTSW 7 80386861 missense probably damaging 0.98
R1922:Fes UTSW 7 80383986 nonsense probably null
R2209:Fes UTSW 7 80380283 missense probably damaging 1.00
R2242:Fes UTSW 7 80381725 missense probably damaging 1.00
R3012:Fes UTSW 7 80387167 missense possibly damaging 0.81
R4607:Fes UTSW 7 80387211 missense probably damaging 1.00
R4608:Fes UTSW 7 80387211 missense probably damaging 1.00
R4982:Fes UTSW 7 80387204 missense probably damaging 1.00
R5516:Fes UTSW 7 80387183 missense probably damaging 1.00
R6120:Fes UTSW 7 80380867 missense probably damaging 1.00
R6148:Fes UTSW 7 80380296 missense probably damaging 1.00
R7161:Fes UTSW 7 80380861 missense probably damaging 0.98
R7401:Fes UTSW 7 80378776 critical splice donor site probably null
R7408:Fes UTSW 7 80378662 missense probably damaging 1.00
R7761:Fes UTSW 7 80380867 missense probably damaging 1.00
R7932:Fes UTSW 7 80379872 missense probably damaging 0.99
R8261:Fes UTSW 7 80383154 missense probably null 1.00
R8815:Fes UTSW 7 80383871 missense possibly damaging 0.89
R8903:Fes UTSW 7 80386811 unclassified probably benign
R8936:Fes UTSW 7 80381725 missense probably damaging 1.00
R9012:Fes UTSW 7 80383136 missense possibly damaging 0.78
R9174:Fes UTSW 7 80380883 missense probably damaging 0.98
R9200:Fes UTSW 7 80382392 missense probably benign 0.00
R9679:Fes UTSW 7 80383302 missense probably benign 0.04
Z1177:Fes UTSW 7 80378030 missense probably damaging 1.00
Predicted Primers
Posted On 2014-01-15