Incidental Mutation 'R1196:Jmjd1c'
ID101131
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission 039268-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R1196 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 67239236 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173236
Predicted Effect probably benign
Transcript: ENSMUST00000173689
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173762
Predicted Effect probably benign
Transcript: ENSMUST00000174408
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 86.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,245,092 I2112T probably benign Het
Agtpbp1 C A 13: 59,450,318 probably benign Het
Ash1l T C 3: 88,983,316 M834T probably damaging Het
Aspg A G 12: 112,116,524 T213A possibly damaging Het
Chpf2 T C 5: 24,589,648 V272A possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddah2 G T 17: 35,061,527 D215Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Fam46c T C 3: 100,473,000 T147A possibly damaging Het
Fbrsl1 T A 5: 110,374,519 M150L probably benign Het
Hmces T A 6: 87,936,182 D306E probably benign Het
Itga2 C T 13: 114,866,155 probably null Het
Krr1 T A 10: 111,975,657 H85Q probably benign Het
Krt83 C T 15: 101,491,433 R6Q probably benign Het
Krtap24-1 T C 16: 88,611,642 M199V probably benign Het
Krtap5-2 A T 7: 142,174,883 C353* probably null Het
Myo7a T G 7: 98,097,673 I178L possibly damaging Het
Myof G A 19: 37,910,960 T1043I probably damaging Het
Noc4l C T 5: 110,650,584 E247K probably damaging Het
Notch4 T C 17: 34,568,863 C437R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1180 A T 2: 88,412,546 N37K probably damaging Het
Olfr859 A G 9: 19,808,632 I105V probably benign Het
Pank4 T C 4: 154,978,173 F584L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ranbp2 T A 10: 58,477,053 F1198L probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Unc13a A G 8: 71,654,986 I554T probably damaging Het
Zfc3h1 A G 10: 115,411,961 D1023G probably damaging Het
Zfp791 T A 8: 85,110,954 K94* probably null Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
R7745:Jmjd1c UTSW 10 67217045 missense probably damaging 0.96
R7897:Jmjd1c UTSW 10 67239865 missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67225842 missense probably benign
R7911:Jmjd1c UTSW 10 67231995 missense probably damaging 1.00
R7980:Jmjd1c UTSW 10 67239865 missense probably damaging 0.96
R7989:Jmjd1c UTSW 10 67225842 missense probably benign
R7992:Jmjd1c UTSW 10 67231995 missense probably damaging 1.00
RF011:Jmjd1c UTSW 10 67220199 missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGACCTTCTTGATGCCATGCAC -3'
(R):5'- TGGATTTCTGCTCAGCAAGATCAGC -3'

Sequencing Primer
(F):5'- ttttaatcacagcagctaggaatc -3'
(R):5'- TAGCCAGTGCAGCGGTG -3'
Posted On2014-01-15