Mutagenetix > Incidental Mutation

Incidental Mutation 'R1167:Sbf2'

101134

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

039240-MU

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110364549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1030 (W1030R)

Ref Sequence

ENSEMBL: ENSMUSP00000126217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]

AlphaFold

E9PXF8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033058
AA Change: W1076R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: W1076R

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000164525
AA Change: W13R

SMART Domains

Protein: ENSMUSP00000128340
Gene: ENSMUSG00000038371
AA Change: W13R

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
Pfam:Myotub-related	28	217	1.5e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164599

SMART Domains

Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	1	339	1.9e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164759
AA Change: W1076R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: W1076R

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166020
AA Change: W1030R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: W1030R

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9406:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

Posted On

2014-01-15