Incidental Mutation 'R1167:Lrrc8e'
ID 101140
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Name leucine rich repeat containing 8 family, member E
Synonyms 1810049O03Rik, C87354
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 4276827-4287470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4285337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 521 (M521L)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
AlphaFold Q66JT1
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053035
AA Change: M521L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: M521L

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4,285,921 (GRCm39) missense probably benign
IGL00943:Lrrc8e APN 8 4,285,658 (GRCm39) missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4,285,080 (GRCm39) missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4,284,084 (GRCm39) missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4,286,141 (GRCm39) missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4,285,392 (GRCm39) missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4,285,429 (GRCm39) missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4,285,776 (GRCm39) missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4,285,401 (GRCm39) missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4,285,733 (GRCm39) missense probably benign
R0601:Lrrc8e UTSW 8 4,285,239 (GRCm39) splice site probably null
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4,281,754 (GRCm39) missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4,284,990 (GRCm39) missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4,284,190 (GRCm39) missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4,285,202 (GRCm39) missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4,284,986 (GRCm39) nonsense probably null
R2290:Lrrc8e UTSW 8 4,281,770 (GRCm39) missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4,284,611 (GRCm39) missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4,283,981 (GRCm39) missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4,285,166 (GRCm39) missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4,284,329 (GRCm39) missense probably benign
R5516:Lrrc8e UTSW 8 4,285,818 (GRCm39) missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4,285,725 (GRCm39) missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4,284,798 (GRCm39) missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4,286,034 (GRCm39) missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4,284,815 (GRCm39) missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4,285,626 (GRCm39) missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4,284,363 (GRCm39) missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4,284,534 (GRCm39) missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4,285,575 (GRCm39) missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4,285,140 (GRCm39) missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4,285,641 (GRCm39) missense probably damaging 1.00
R8355:Lrrc8e UTSW 8 4,284,018 (GRCm39) missense probably benign 0.02
R8487:Lrrc8e UTSW 8 4,284,218 (GRCm39) missense probably damaging 1.00
R8810:Lrrc8e UTSW 8 4,285,070 (GRCm39) missense probably benign 0.03
R8971:Lrrc8e UTSW 8 4,284,141 (GRCm39) missense probably damaging 1.00
R9088:Lrrc8e UTSW 8 4,284,410 (GRCm39) missense probably damaging 0.96
R9150:Lrrc8e UTSW 8 4,286,030 (GRCm39) missense probably benign 0.06
R9225:Lrrc8e UTSW 8 4,284,561 (GRCm39) missense probably damaging 1.00
R9255:Lrrc8e UTSW 8 4,284,504 (GRCm39) missense probably damaging 1.00
R9442:Lrrc8e UTSW 8 4,283,964 (GRCm39) missense probably benign 0.01
R9463:Lrrc8e UTSW 8 4,285,185 (GRCm39) missense probably damaging 0.99
R9475:Lrrc8e UTSW 8 4,285,346 (GRCm39) missense probably benign
Z1176:Lrrc8e UTSW 8 4,284,822 (GRCm39) missense probably damaging 0.97
Predicted Primers
Posted On 2014-01-15