Mutagenetix > Incidental Mutation

Incidental Mutation 'R1196:Itga2'

101142

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

DX5, VLA-2 receptor, alpha 2 subunit, CD49B

MMRRC Submission

039268-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114969617-115068636 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 115002691 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117]

AlphaFold

Q62469

Predicted Effect

probably null
Transcript: ENSMUST00000056117

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 99.4%
3x: 98.3%
10x: 94.9%
20x: 86.8%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	C	5: 114,383,153 (GRCm39)	I2112T	probably benign	Het
Agtpbp1	C	A	13: 59,598,132 (GRCm39)		probably benign	Het
Ash1l	T	C	3: 88,890,623 (GRCm39)	M834T	probably damaging	Het
Aspg	A	G	12: 112,082,958 (GRCm39)	T213A	possibly damaging	Het
Chpf2	T	C	5: 24,794,646 (GRCm39)	V272A	possibly damaging	Het
D6Ertd527e	C	G	6: 87,088,506 (GRCm39)	T223S	unknown	Het
Ddah2	G	T	17: 35,280,503 (GRCm39)	D215Y	probably damaging	Het
Dna2	C	T	10: 62,784,966 (GRCm39)	R28W	probably benign	Het
Fbrsl1	T	A	5: 110,522,385 (GRCm39)	M150L	probably benign	Het
Hmces	T	A	6: 87,913,164 (GRCm39)	D306E	probably benign	Het
Jmjd1c	T	C	10: 67,075,015 (GRCm39)		probably benign	Het
Krr1	T	A	10: 111,811,562 (GRCm39)	H85Q	probably benign	Het
Krt87	C	T	15: 101,389,314 (GRCm39)	R6Q	probably benign	Het
Krtap24-1	T	C	16: 88,408,530 (GRCm39)	M199V	probably benign	Het
Krtap5-2	A	T	7: 141,728,620 (GRCm39)	C353*	probably null	Het
Myo7a	T	G	7: 97,746,880 (GRCm39)	I178L	possibly damaging	Het
Myof	G	A	19: 37,899,408 (GRCm39)	T1043I	probably damaging	Het
Noc4l	C	T	5: 110,798,450 (GRCm39)	E247K	probably damaging	Het
Notch4	T	C	17: 34,787,837 (GRCm39)	C437R	probably damaging	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Or4p19	A	T	2: 88,242,890 (GRCm39)	N37K	probably damaging	Het
Or7e168	A	G	9: 19,719,928 (GRCm39)	I105V	probably benign	Het
Pank4	T	C	4: 155,062,630 (GRCm39)	F584L	probably damaging	Het
Prl2c2	G	C	13: 13,176,786 (GRCm39)	T47R	probably damaging	Het
Ranbp2	T	A	10: 58,312,875 (GRCm39)	F1198L	probably damaging	Het
Sf3b1	C	G	1: 55,058,554 (GRCm39)	E12Q	possibly damaging	Het
Tent5c	T	C	3: 100,380,316 (GRCm39)	T147A	possibly damaging	Het
Ttc28	G	A	5: 111,373,543 (GRCm39)	S962N	probably damaging	Het
Unc13a	A	G	8: 72,107,630 (GRCm39)	I554T	probably damaging	Het
Zfc3h1	A	G	10: 115,247,866 (GRCm39)	D1023G	probably damaging	Het
Zfp791	T	A	8: 85,837,583 (GRCm39)	K94*	probably null	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	115,014,161 (GRCm39)	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114,996,168 (GRCm39)	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114,973,627 (GRCm39)	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114,990,947 (GRCm39)	splice site	probably benign
IGL01965:Itga2	APN	13	114,984,600 (GRCm39)	splice site	probably benign
IGL01987:Itga2	APN	13	114,984,482 (GRCm39)	nonsense	probably null
IGL02334:Itga2	APN	13	115,001,845 (GRCm39)	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114,993,258 (GRCm39)	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114,973,106 (GRCm39)	unclassified	probably benign
IGL03191:Itga2	APN	13	114,973,020 (GRCm39)	unclassified	probably benign
IGL03209:Itga2	APN	13	115,017,168 (GRCm39)	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	115,002,735 (GRCm39)	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114,973,115 (GRCm39)	unclassified	probably benign
R0152:Itga2	UTSW	13	115,002,850 (GRCm39)	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114,990,435 (GRCm39)	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114,982,392 (GRCm39)	missense	probably benign	0.15
R0599:Itga2	UTSW	13	114,993,186 (GRCm39)	splice site	probably benign
R0688:Itga2	UTSW	13	114,976,090 (GRCm39)	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114,998,911 (GRCm39)	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114,996,168 (GRCm39)	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	115,007,150 (GRCm39)	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	115,007,150 (GRCm39)	missense	possibly damaging	0.92
R0836:Itga2	UTSW	13	114,993,215 (GRCm39)	missense	probably damaging	0.99
R1546:Itga2	UTSW	13	114,985,956 (GRCm39)	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114,993,832 (GRCm39)	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114,993,263 (GRCm39)	missense	probably damaging	1.00
R1834:Itga2	UTSW	13	114,993,262 (GRCm39)	missense	probably damaging	0.98
R2180:Itga2	UTSW	13	114,985,917 (GRCm39)	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	115,007,141 (GRCm39)	missense	probably benign	0.05
R2518:Itga2	UTSW	13	115,017,578 (GRCm39)	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	115,005,835 (GRCm39)	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114,976,054 (GRCm39)	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	115,007,161 (GRCm39)	missense	probably benign	0.01
R4193:Itga2	UTSW	13	115,023,185 (GRCm39)	nonsense	probably null
R4290:Itga2	UTSW	13	115,002,709 (GRCm39)	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114,980,019 (GRCm39)	missense	probably damaging	0.97
R4460:Itga2	UTSW	13	114,980,019 (GRCm39)	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	115,014,229 (GRCm39)	missense	probably benign	0.03
R4655:Itga2	UTSW	13	115,009,805 (GRCm39)	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114,993,909 (GRCm39)	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114,990,302 (GRCm39)	nonsense	probably null
R5093:Itga2	UTSW	13	114,992,717 (GRCm39)	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114,979,971 (GRCm39)	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114,979,971 (GRCm39)	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	115,021,042 (GRCm39)	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114,976,106 (GRCm39)	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	115,004,742 (GRCm39)	missense	probably benign	0.02
R5923:Itga2	UTSW	13	115,021,055 (GRCm39)	missense	probably benign	0.02
R6163:Itga2	UTSW	13	115,002,726 (GRCm39)	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114,976,097 (GRCm39)	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114,982,424 (GRCm39)	missense	probably benign	0.05
R6283:Itga2	UTSW	13	115,005,786 (GRCm39)	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114,980,009 (GRCm39)	missense	probably benign
R6510:Itga2	UTSW	13	115,009,816 (GRCm39)	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114,973,061 (GRCm39)	missense	possibly damaging	0.93
R6869:Itga2	UTSW	13	115,012,073 (GRCm39)	splice site	probably null
R7073:Itga2	UTSW	13	114,996,149 (GRCm39)	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	115,037,066 (GRCm39)	missense	unknown
R7236:Itga2	UTSW	13	115,014,227 (GRCm39)	missense	probably benign
R7269:Itga2	UTSW	13	115,023,225 (GRCm39)	nonsense	probably null
R7296:Itga2	UTSW	13	114,993,930 (GRCm39)	splice site	probably null
R7350:Itga2	UTSW	13	114,973,738 (GRCm39)	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	115,005,753 (GRCm39)	missense	probably benign	0.06
R7501:Itga2	UTSW	13	115,012,095 (GRCm39)	missense	probably damaging	1.00
R7687:Itga2	UTSW	13	115,002,796 (GRCm39)	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114,990,427 (GRCm39)	missense	probably benign
R7810:Itga2	UTSW	13	115,002,715 (GRCm39)	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114,990,291 (GRCm39)	missense	probably damaging	1.00
R8948:Itga2	UTSW	13	115,009,866 (GRCm39)	missense	probably damaging	1.00
R9132:Itga2	UTSW	13	115,014,298 (GRCm39)	nonsense	probably null
R9153:Itga2	UTSW	13	115,001,941 (GRCm39)	missense	probably benign	0.00
R9159:Itga2	UTSW	13	115,014,298 (GRCm39)	nonsense	probably null
R9651:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
R9652:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
R9653:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
Z1088:Itga2	UTSW	13	114,993,868 (GRCm39)	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114,990,237 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAAGTTCAGGTCTTGTTTCCTGCC -3'
(R):5'- TGAGAGTTTCACTGTCACGGTCCC -3'

Sequencing Primer
(F):5'- accactgcaatttatttcctttttc -3'
(R):5'- CAGCACCAGTTTCTTGAAGG -3'

Posted On

2014-01-15