Mutagenetix > Incidental Mutations

Incidental Mutation 'R1199:Irs1'

101156

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

039269-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.626) question?

Stock #

R1199 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82289626 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 290 (S290C)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069799
AA Change: S290C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: S290C

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.2162

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	T	9: 108,393,477	H80L	possibly damaging	Het
A1bg	A	T	15: 60,919,635		probably null	Het
Aco2	C	T	15: 81,895,193	S33L	probably damaging	Het
Agrn	T	A	4: 156,172,299	Y1283F	probably benign	Het
Akap6	T	C	12: 52,796,190	V107A	probably damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Btnl9	A	T	11: 49,180,747	V83E	probably damaging	Het
Camk2a	T	A	18: 60,952,324	C131*	probably null	Het
Ccdc14	C	T	16: 34,723,828	T852M	probably damaging	Het
Cntn4	T	C	6: 106,353,597		probably benign	Het
Cp	T	G	3: 19,977,152	S585R	probably damaging	Het
Cpt1b	G	A	15: 89,419,010	A614V	probably benign	Het
Crygn	T	C	5: 24,751,148	Y153C	probably damaging	Het
Dennd1a	A	T	2: 37,961,716	D53E	probably damaging	Het
Deptor	T	C	15: 55,252,010	C357R	probably benign	Het
Dnajc28	C	A	16: 91,618,642		probably benign	Het
Eml6	G	A	11: 29,755,044	A1500V	possibly damaging	Het
Fgd5	T	A	6: 91,986,978	L64Q	possibly damaging	Het
Fgfbp1	A	G	5: 43,979,597	Y118H	probably damaging	Het
Ftcd	G	A	10: 76,579,819	R135H	probably damaging	Het
Gm5174	A	T	10: 86,657,325		noncoding transcript	Het
Gpr37l1	A	T	1: 135,166,972	L178Q	probably damaging	Het
Gtf2ird1	A	G	5: 134,411,064	V104A	possibly damaging	Het
Kel	C	T	6: 41,688,591	V532I	possibly damaging	Het
Kif1c	A	G	11: 70,708,601	E442G	possibly damaging	Het
Klhdc10	T	A	6: 30,449,494	V185D	probably damaging	Het
Lpp	C	T	16: 24,681,860	R141C	probably damaging	Het
Olfr1025-ps1	A	G	2: 85,918,035	I37V	probably benign	Het
Olfr68	A	T	7: 103,777,985	M120K	probably damaging	Het
Pcnx2	G	T	8: 125,887,314	P466H	possibly damaging	Het
Pcsk1	A	T	13: 75,096,413		probably benign	Het
Pkd2l2	T	C	18: 34,438,216		probably null	Het
Pomt1	A	G	2: 32,250,492	N454S	probably benign	Het
Samhd1	A	T	2: 157,109,461	I452N	probably damaging	Het
Sez6	A	G	11: 77,953,885	Q178R	probably benign	Het
Slc25a44	A	G	3: 88,420,986	V66A	probably damaging	Het
Slc46a2	T	C	4: 59,914,189	T245A	probably benign	Het
Slc4a4	G	A	5: 89,215,794		probably null	Het
Spata6	T	A	4: 111,799,145	C329S	possibly damaging	Het
Srrm2	A	T	17: 23,817,751		probably benign	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Svil	T	A	18: 5,059,217		probably benign	Het
Tenm3	G	T	8: 48,235,582	S2323R	probably damaging	Het
Tsc1	G	A	2: 28,665,626	R245Q	probably damaging	Het
Ttn	A	G	2: 76,908,756	V3813A	probably benign	Het
Ttn	G	A	2: 76,950,044	T1121M	possibly damaging	Het
Ush2a	G	A	1: 188,759,795	V3094I	probably benign	Het
Vcan	A	G	13: 89,679,794		probably null	Het
Vmn1r189	A	T	13: 22,102,658	L3Q	probably damaging	Het
Vmn1r60	A	C	7: 5,544,972	V43G	probably damaging	Het
Vmn2r110	A	G	17: 20,583,263	I350T	probably benign	Het
Vmn2r86	T	A	10: 130,448,574		probably benign	Het
Xrn1	A	G	9: 95,981,761		probably benign	Het
Zfp251	C	T	15: 76,854,236	R219Q	possibly damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCGGAAATCGCAGGGACTAGAAC -3'
(R):5'- ATGCAAGTGGATGACTCCGTGGTG -3'

Sequencing Primer
(F):5'- GGTACTACTAGATGACAGACTCACTG -3'
(R):5'- TGGTGGCCCAGAACATGC -3'

Posted On

2014-01-15