Mutagenetix > Incidental Mutations

Incidental Mutation 'R1167:Olfr790'

101161

Institutional Source

Beutler Lab

Gene Symbol

Olfr790

Ensembl Gene

ENSMUSG00000044025

Gene Name

olfactory receptor 790

Synonyms

GA_x6K02T2PULF-11179777-11180721, MOR112-1

MMRRC Submission

039240-MU

Accession Numbers

Genbank: NM_146933

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129498492-129503342 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 129501150 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 89 (V89I)

Ref Sequence

ENSEMBL: ENSMUSP00000151759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056002] [ENSMUST00000203966] [ENSMUST00000215067] [ENSMUST00000218901]

Predicted Effect

probably benign
Transcript: ENSMUST00000056002
AA Change: V81I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000052235
Gene: ENSMUSG00000044025
AA Change: V81I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	315	5.6e-53	PFAM
Pfam:7tm_1	47	296	1.3e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203966
AA Change: V81I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000145450
Gene: ENSMUSG00000044025
AA Change: V81I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	315	5.6e-53	PFAM
Pfam:7tm_1	47	296	1.3e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215067
AA Change: V81I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000218901
AA Change: V89I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Olfr790

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01132:Olfr790	APN	10	129501646	missense	probably damaging	1.00
IGL01575:Olfr790	APN	10	129501567	missense	probably benign	0.01
IGL02389:Olfr790	APN	10	129501070	missense	probably benign
IGL02601:Olfr790	APN	10	129501854	makesense	probably null
G5030:Olfr790	UTSW	10	129501537	missense	probably benign	0.00
R0785:Olfr790	UTSW	10	129500881	critical splice acceptor site	probably null
R0850:Olfr790	UTSW	10	129501724	missense	probably damaging	0.99
R0899:Olfr790	UTSW	10	129501432	missense	probably damaging	1.00
R1515:Olfr790	UTSW	10	129501591	missense	probably damaging	1.00
R1557:Olfr790	UTSW	10	129501622	missense	probably damaging	1.00
R1759:Olfr790	UTSW	10	129500906	missense	probably benign	0.00
R1892:Olfr790	UTSW	10	129501033	missense	probably benign	0.02
R4296:Olfr790	UTSW	10	129501470	nonsense	probably null
R4681:Olfr790	UTSW	10	129501564	missense	probably damaging	1.00
R5046:Olfr790	UTSW	10	129501309	missense	possibly damaging	0.57
R5309:Olfr790	UTSW	10	129501514	missense	probably damaging	1.00
R5312:Olfr790	UTSW	10	129501514	missense	probably damaging	1.00
R5550:Olfr790	UTSW	10	129501783	missense	probably damaging	1.00
R5788:Olfr790	UTSW	10	129500894	missense	probably benign
R5788:Olfr790	UTSW	10	129500910	start codon destroyed	probably null	0.99
R7457:Olfr790	UTSW	10	129501706	missense	probably damaging	1.00
R7782:Olfr790	UTSW	10	129501151	missense	probably benign	0.01
R7969:Olfr790	UTSW	10	129501847	missense	probably benign	0.14
R8512:Olfr790	UTSW	10	129501627	missense	probably damaging	1.00

Predicted Primers

Posted On

2014-01-15