Incidental Mutation 'R1167:Olfr790'
ID 101161
Institutional Source Beutler Lab
Gene Symbol Olfr790
Ensembl Gene ENSMUSG00000044025
Gene Name olfactory receptor 790
Synonyms GA_x6K02T2PULF-11179777-11180721, MOR112-1
MMRRC Submission 039240-MU
Accession Numbers

Genbank: NM_146933
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129498492-129503342 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 129501150 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 89 (V89I)
Ref Sequence ENSEMBL: ENSMUSP00000151759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056002] [ENSMUST00000203966] [ENSMUST00000215067] [ENSMUST00000218901]
AlphaFold Q8VGJ3
Predicted Effect probably benign
Transcript: ENSMUST00000056002
AA Change: V81I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052235
Gene: ENSMUSG00000044025
AA Change: V81I

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 5.6e-53 PFAM
Pfam:7tm_1 47 296 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203966
AA Change: V81I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145450
Gene: ENSMUSG00000044025
AA Change: V81I

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 5.6e-53 PFAM
Pfam:7tm_1 47 296 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215067
AA Change: V81I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000218901
AA Change: V89I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Olfr790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Olfr790 APN 10 129501646 missense probably damaging 1.00
IGL01575:Olfr790 APN 10 129501567 missense probably benign 0.01
IGL02389:Olfr790 APN 10 129501070 missense probably benign
IGL02601:Olfr790 APN 10 129501854 makesense probably null
G5030:Olfr790 UTSW 10 129501537 missense probably benign 0.00
R0785:Olfr790 UTSW 10 129500881 critical splice acceptor site probably null
R0850:Olfr790 UTSW 10 129501724 missense probably damaging 0.99
R0899:Olfr790 UTSW 10 129501432 missense probably damaging 1.00
R1515:Olfr790 UTSW 10 129501591 missense probably damaging 1.00
R1557:Olfr790 UTSW 10 129501622 missense probably damaging 1.00
R1759:Olfr790 UTSW 10 129500906 missense probably benign 0.00
R1892:Olfr790 UTSW 10 129501033 missense probably benign 0.02
R4296:Olfr790 UTSW 10 129501470 nonsense probably null
R4681:Olfr790 UTSW 10 129501564 missense probably damaging 1.00
R5046:Olfr790 UTSW 10 129501309 missense possibly damaging 0.57
R5309:Olfr790 UTSW 10 129501514 missense probably damaging 1.00
R5312:Olfr790 UTSW 10 129501514 missense probably damaging 1.00
R5550:Olfr790 UTSW 10 129501783 missense probably damaging 1.00
R5788:Olfr790 UTSW 10 129500894 missense probably benign
R5788:Olfr790 UTSW 10 129500910 start codon destroyed probably null 0.99
R7457:Olfr790 UTSW 10 129501706 missense probably damaging 1.00
R7782:Olfr790 UTSW 10 129501151 missense probably benign 0.01
R7969:Olfr790 UTSW 10 129501847 missense probably benign 0.14
R8512:Olfr790 UTSW 10 129501627 missense probably damaging 1.00
R8966:Olfr790 UTSW 10 129501082 missense probably damaging 0.98
R9352:Olfr790 UTSW 10 129501495 missense probably benign 0.14
R9436:Olfr790 UTSW 10 129501100 missense probably damaging 1.00
R9456:Olfr790 UTSW 10 129501646 missense probably damaging 1.00
Predicted Primers
Posted On 2014-01-15