Incidental Mutation 'R1167:Rab1a'
ID 101163
Institutional Source Beutler Lab
Gene Symbol Rab1a
Ensembl Gene ENSMUSG00000020149
Gene Name RAB1A, member RAS oncogene family
Synonyms Ypt1, Rab1, Rab-1, Gtbp, ras-related YPT1 protein
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 20201432-20226856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20223172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 91 (T91K)
Ref Sequence ENSEMBL: ENSMUSP00000020358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020358] [ENSMUST00000050611] [ENSMUST00000109601] [ENSMUST00000109602] [ENSMUST00000163483]
AlphaFold P62821
Predicted Effect possibly damaging
Transcript: ENSMUST00000020358
AA Change: T91K

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020358
Gene: ENSMUSG00000020149
AA Change: T91K

DomainStartEndE-ValueType
RAB 9 172 2.9e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050611
SMART Domains Protein: ENSMUSP00000054943
Gene: ENSMUSG00000044066

DomainStartEndE-ValueType
low complexity region 178 190 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
SPEC 605 706 1.28e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109601
SMART Domains Protein: ENSMUSP00000105230
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
Pfam:Ras 10 63 1.4e-18 PFAM
Pfam:Miro 10 93 8.4e-7 PFAM
Pfam:Ras 61 95 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109602
SMART Domains Protein: ENSMUSP00000105231
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
Pfam:Ras 10 31 7.6e-6 PFAM
Pfam:Ras 29 107 8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152728
Predicted Effect possibly damaging
Transcript: ENSMUST00000163483
AA Change: T94K

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127330
Gene: ENSMUSG00000020149
AA Change: T94K

DomainStartEndE-ValueType
RAB 12 175 2.9e-107 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Rab1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Rab1a APN 11 20224727 missense possibly damaging 0.92
IGL01639:Rab1a APN 11 20223185 splice site probably benign
IGL01982:Rab1a APN 11 20224717 missense probably benign 0.17
R0504:Rab1a UTSW 11 20223169 missense probably damaging 0.99
R2967:Rab1a UTSW 11 20223068 splice site probably null
R3703:Rab1a UTSW 11 20224506 splice site probably benign
R5623:Rab1a UTSW 11 20201626 utr 5 prime probably benign
R5897:Rab1a UTSW 11 20218867 nonsense probably null
R7864:Rab1a UTSW 11 20215673 nonsense probably null
Predicted Primers
Posted On 2014-01-15