Incidental Mutation 'R1167:Myocd'
ID101169
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65196377 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000098603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101042
AA Change: D113E

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542
AA Change: D113E

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102635
AA Change: D241E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: D241E

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108695
AA Change: D241E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: D241E

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144399
AA Change: D115E
SMART Domains Protein: ENSMUSP00000115572
Gene: ENSMUSG00000020542
AA Change: D115E

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 160 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
myra UTSW 11 65178859 missense probably benign 0.10
Nate UTSW 11 65233088 splice site probably null
R0838_Myocd_053 UTSW 11 65178932 missense probably benign 0.00
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0453:Myocd UTSW 11 65196225 missense probably damaging 1.00
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1630:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1740:Myocd UTSW 11 65218521 splice site probably benign
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1968:Myocd UTSW 11 65200907 missense probably damaging 1.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4865:Myocd UTSW 11 65179030 splice site probably null
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 splice site probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 splice site probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7613:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7718:Myocd UTSW 11 65218626 missense probably damaging 1.00
R7956:Myocd UTSW 11 65269668 missense possibly damaging 0.50
R8345:Myocd UTSW 11 65187132 nonsense probably null
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Z1186:Myocd UTSW 11 65184592 missense probably benign
Z1187:Myocd UTSW 11 65184592 missense probably benign
Z1188:Myocd UTSW 11 65184592 missense probably benign
Z1189:Myocd UTSW 11 65184592 missense probably benign
Z1190:Myocd UTSW 11 65184592 missense probably benign
Z1191:Myocd UTSW 11 65184592 missense probably benign
Z1192:Myocd UTSW 11 65184592 missense probably benign
Predicted Primers
Posted On2014-01-15