Mutagenetix > Incidental Mutations

Incidental Mutation 'R1167:Myocd'

101169

Institutional Source

Beutler Lab

Gene Symbol

Myocd

Ensembl Gene

ENSMUSG00000020542

Gene Name

myocardin

Synonyms

Srfcp

MMRRC Submission

039240-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65176561-65269989 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 65196377 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 113 (D113E)

Ref Sequence

ENSEMBL: ENSMUSP00000098603 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101042
AA Change: D113E

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542
AA Change: D113E

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
SCOP:d1lsha3	140	221	4e-3	SMART
SAP	252	286	1.29e-8	SMART
low complexity region	326	343	N/A	INTRINSIC
low complexity region	371	383	N/A	INTRINSIC
coiled coil region	396	435	N/A	INTRINSIC
low complexity region	557	573	N/A	INTRINSIC
low complexity region	615	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102635
AA Change: D241E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: D241E

Domain	Start	End	E-Value	Type
RPEL	18	43	4e-1	SMART
RPEL	62	87	9.26e0	SMART
RPEL	106	131	1.15e-6	SMART
low complexity region	147	160	N/A	INTRINSIC
low complexity region	247	260	N/A	INTRINSIC
SCOP:d1lsha3	268	349	4e-3	SMART
SAP	380	414	1.29e-8	SMART
low complexity region	454	471	N/A	INTRINSIC
low complexity region	499	511	N/A	INTRINSIC
coiled coil region	524	563	N/A	INTRINSIC
low complexity region	695	709	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108695
AA Change: D241E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: D241E

Domain	Start	End	E-Value	Type
RPEL	18	43	4e-1	SMART
RPEL	62	87	9.26e0	SMART
RPEL	106	131	1.15e-6	SMART
low complexity region	147	160	N/A	INTRINSIC
low complexity region	247	260	N/A	INTRINSIC
SCOP:d1lsha3	268	349	5e-3	SMART
SAP	380	414	1.29e-8	SMART
low complexity region	454	471	N/A	INTRINSIC
low complexity region	499	511	N/A	INTRINSIC
coiled coil region	524	563	N/A	INTRINSIC
low complexity region	685	701	N/A	INTRINSIC
low complexity region	743	757	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000144399
AA Change: D115E

SMART Domains

Protein: ENSMUSP00000115572
Gene: ENSMUSG00000020542
AA Change: D115E

Domain	Start	End	E-Value	Type
low complexity region	22	35	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	160	195	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Myocd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Myocd	APN	11	65180944	critical splice acceptor site	probably null
IGL00481:Myocd	APN	11	65187154	missense	probably damaging	0.99
IGL00857:Myocd	APN	11	65178836	missense	possibly damaging	0.93
IGL01012:Myocd	APN	11	65184625	missense	possibly damaging	0.51
IGL01570:Myocd	APN	11	65200807	missense	probably benign	0.00
IGL01865:Myocd	APN	11	65200897	missense	probably benign	0.30
IGL01938:Myocd	APN	11	65187088	missense	probably damaging	1.00
IGL02324:Myocd	APN	11	65178658	missense	probably benign	0.01
IGL02598:Myocd	APN	11	65183470	missense	probably benign	0.31
IGL02886:Myocd	APN	11	65178743	missense	probably damaging	0.99
IGL03008:Myocd	APN	11	65187566	missense	probably damaging	0.98
IGL03034:Myocd	APN	11	65218685	missense	probably benign	0.00
harvey	UTSW	11	65179030	splice site	probably null
irma	UTSW	11	65196394	missense	probably damaging	0.97
myra	UTSW	11	65178859	missense	probably benign	0.10
Nate	UTSW	11	65233088	splice site	probably null
R0838_Myocd_053	UTSW	11	65178932	missense	probably benign	0.00
R0078:Myocd	UTSW	11	65187464	missense	possibly damaging	0.96
R0097:Myocd	UTSW	11	65179014	missense	possibly damaging	0.67
R0097:Myocd	UTSW	11	65179014	missense	possibly damaging	0.67
R0234:Myocd	UTSW	11	65187240	missense	probably benign	0.01
R0234:Myocd	UTSW	11	65187240	missense	probably benign	0.01
R0453:Myocd	UTSW	11	65196225	missense	probably damaging	1.00
R0523:Myocd	UTSW	11	65180902	missense	probably damaging	1.00
R0838:Myocd	UTSW	11	65178932	missense	probably benign	0.00
R0899:Myocd	UTSW	11	65195192	missense	possibly damaging	0.50
R1472:Myocd	UTSW	11	65187504	missense	probably benign	0.01
R1508:Myocd	UTSW	11	65184516	missense	probably damaging	0.98
R1620:Myocd	UTSW	11	65196394	missense	probably damaging	0.97
R1630:Myocd	UTSW	11	65196394	missense	probably damaging	0.97
R1731:Myocd	UTSW	11	65200888	missense	probably benign	0.30
R1740:Myocd	UTSW	11	65218521	splice site	probably benign
R1769:Myocd	UTSW	11	65178701	missense	probably benign	0.01
R1823:Myocd	UTSW	11	65178670	missense	probably benign	0.00
R1968:Myocd	UTSW	11	65200907	missense	probably damaging	1.00
R1997:Myocd	UTSW	11	65204321	nonsense	probably null
R2018:Myocd	UTSW	11	65187028	missense	probably damaging	1.00
R2105:Myocd	UTSW	11	65218658	nonsense	probably null
R2314:Myocd	UTSW	11	65200807	missense	probably damaging	1.00
R4330:Myocd	UTSW	11	65223764	missense	probably benign	0.12
R4331:Myocd	UTSW	11	65223764	missense	probably benign	0.12
R4603:Myocd	UTSW	11	65187745	missense	possibly damaging	0.82
R4619:Myocd	UTSW	11	65178428	utr 3 prime	probably benign
R4631:Myocd	UTSW	11	65178859	missense	probably benign	0.10
R4865:Myocd	UTSW	11	65179030	splice site	probably null
R4974:Myocd	UTSW	11	65183473	missense	possibly damaging	0.78
R4976:Myocd	UTSW	11	65222050	missense	probably benign	0.00
R5478:Myocd	UTSW	11	65233088	splice site	probably null
R5499:Myocd	UTSW	11	65178749	missense	possibly damaging	0.62
R6052:Myocd	UTSW	11	65196256	missense	probably damaging	1.00
R6356:Myocd	UTSW	11	65218570	splice site	probably null
R7144:Myocd	UTSW	11	65218648	missense	probably damaging	1.00
R7261:Myocd	UTSW	11	65187596	missense	probably damaging	0.98
R7354:Myocd	UTSW	11	65187493	missense	probably benign	0.00
R7461:Myocd	UTSW	11	65218603	missense	probably damaging	1.00
R7613:Myocd	UTSW	11	65218603	missense	probably damaging	1.00
R7718:Myocd	UTSW	11	65218626	missense	probably damaging	1.00
R7956:Myocd	UTSW	11	65269668	missense	possibly damaging	0.50
R8345:Myocd	UTSW	11	65187132	nonsense	probably null
X0057:Myocd	UTSW	11	65183445	missense	possibly damaging	0.87
Z1186:Myocd	UTSW	11	65184592	missense	probably benign
Z1187:Myocd	UTSW	11	65184592	missense	probably benign
Z1188:Myocd	UTSW	11	65184592	missense	probably benign
Z1189:Myocd	UTSW	11	65184592	missense	probably benign
Z1190:Myocd	UTSW	11	65184592	missense	probably benign
Z1191:Myocd	UTSW	11	65184592	missense	probably benign
Z1192:Myocd	UTSW	11	65184592	missense	probably benign

Predicted Primers

Posted On

2014-01-15