Incidental Mutation 'R1167:Foxn1'
ID 101173
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Name forkhead box N1
Synonyms whn, D11Bhm185e, Hfh11
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 78248403-78277384 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78249892 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 544 (N544K)
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
AlphaFold Q61575
Predicted Effect probably damaging
Transcript: ENSMUST00000108294
AA Change: N544K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057
AA Change: N544K

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Setbp1 G A 18: 78,900,451 (GRCm39) A1072V possibly damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78,262,109 (GRCm39) missense probably benign 0.24
IGL01391:Foxn1 APN 11 78,252,320 (GRCm39) missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78,251,732 (GRCm39) missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78,261,986 (GRCm39) missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78,261,950 (GRCm39) missense probably benign 0.16
Nudnik UTSW 11 78,252,438 (GRCm39) missense possibly damaging 0.52
R0200:Foxn1 UTSW 11 78,251,866 (GRCm39) missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78,261,970 (GRCm39) missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78,249,825 (GRCm39) missense probably benign 0.01
R1112:Foxn1 UTSW 11 78,261,856 (GRCm39) missense probably benign 0.29
R1251:Foxn1 UTSW 11 78,249,611 (GRCm39) missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78,251,933 (GRCm39) missense probably benign
R1506:Foxn1 UTSW 11 78,256,761 (GRCm39) splice site probably benign
R1616:Foxn1 UTSW 11 78,249,692 (GRCm39) missense probably benign 0.00
R1795:Foxn1 UTSW 11 78,262,051 (GRCm39) missense probably benign 0.01
R1905:Foxn1 UTSW 11 78,262,636 (GRCm39) splice site probably null
R1906:Foxn1 UTSW 11 78,262,636 (GRCm39) splice site probably null
R1975:Foxn1 UTSW 11 78,256,763 (GRCm39) splice site probably benign
R1976:Foxn1 UTSW 11 78,256,763 (GRCm39) splice site probably benign
R2206:Foxn1 UTSW 11 78,249,630 (GRCm39) missense probably benign 0.02
R2207:Foxn1 UTSW 11 78,249,630 (GRCm39) missense probably benign 0.02
R2988:Foxn1 UTSW 11 78,249,603 (GRCm39) missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78,249,603 (GRCm39) missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78,261,989 (GRCm39) missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78,252,459 (GRCm39) missense probably benign 0.18
R5533:Foxn1 UTSW 11 78,256,792 (GRCm39) missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78,252,085 (GRCm39) missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78,251,786 (GRCm39) missense probably benign 0.00
R7176:Foxn1 UTSW 11 78,251,693 (GRCm39) missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78,249,615 (GRCm39) missense probably damaging 1.00
R7515:Foxn1 UTSW 11 78,261,970 (GRCm39) missense possibly damaging 0.67
R7562:Foxn1 UTSW 11 78,261,958 (GRCm39) missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78,256,790 (GRCm39) missense probably benign 0.29
R8838:Foxn1 UTSW 11 78,252,438 (GRCm39) missense possibly damaging 0.52
R9255:Foxn1 UTSW 11 78,252,399 (GRCm39) nonsense probably null
R9512:Foxn1 UTSW 11 78,262,035 (GRCm39) missense
X0067:Foxn1 UTSW 11 78,252,368 (GRCm39) missense probably damaging 1.00
Predicted Primers
Posted On 2014-01-15