Mutagenetix > Incidental Mutation

Incidental Mutation 'R1167:Ryr2'

101177

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

039240-MU

Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11553102-12106945 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11660113 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 3376 (V3376A)

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021750
AA Change: V3376A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: V3376A

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170156
AA Change: V3376A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: V3376A

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000220712
AA Change: V41A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221941

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,834,092 (GRCm38)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,618,604 (GRCm38)	splice site	probably null
IGL00838:Ryr2	APN	13	11,568,503 (GRCm38)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,585,478 (GRCm38)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,735,502 (GRCm38)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,703,544 (GRCm38)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,638,485 (GRCm38)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,587,239 (GRCm38)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,556,685 (GRCm38)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,591,352 (GRCm38)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,742,036 (GRCm38)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,799,837 (GRCm38)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,851,204 (GRCm38)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,721,790 (GRCm38)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,721,761 (GRCm38)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,601,758 (GRCm38)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,591,316 (GRCm38)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,594,968 (GRCm38)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,692,677 (GRCm38)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,585,480 (GRCm38)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,601,842 (GRCm38)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,595,425 (GRCm38)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,554,550 (GRCm38)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,790,363 (GRCm38)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,790,363 (GRCm38)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,597,112 (GRCm38)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,747,564 (GRCm38)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,572,257 (GRCm38)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,792,762 (GRCm38)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,735,556 (GRCm38)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,759,759 (GRCm38)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,737,873 (GRCm38)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,741,869 (GRCm38)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,730,388 (GRCm38)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,747,658 (GRCm38)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,619,496 (GRCm38)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,722,721 (GRCm38)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,605,244 (GRCm38)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,745,198 (GRCm38)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,745,674 (GRCm38)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,705,699 (GRCm38)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,554,511 (GRCm38)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,605,189 (GRCm38)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,738,320 (GRCm38)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,655,677 (GRCm38)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,595,190 (GRCm38)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,707,793 (GRCm38)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,918,319 (GRCm38)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,591,269 (GRCm38)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,759,835 (GRCm38)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,684,479 (GRCm38)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,643,902 (GRCm38)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,635,582 (GRCm38)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,853,150 (GRCm38)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,742,023 (GRCm38)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,568,563 (GRCm38)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,724,387 (GRCm38)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,772,416 (GRCm38)	missense	probably benign
IGL03410:Ryr2	APN	13	11,588,147 (GRCm38)	missense	probably damaging	0.99
Arruda	UTSW	13	11,643,895 (GRCm38)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,879,496 (GRCm38)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,555,448 (GRCm38)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,595,014 (GRCm38)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,717,141 (GRCm38)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,665,962 (GRCm38)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,761,306 (GRCm38)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,707,796 (GRCm38)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,594,755 (GRCm38)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,555,448 (GRCm38)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,824,379 (GRCm38)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,665,919 (GRCm38)	missense	probably benign
R0018:Ryr2	UTSW	13	11,595,223 (GRCm38)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,595,784 (GRCm38)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,595,784 (GRCm38)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,669,038 (GRCm38)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,869,116 (GRCm38)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,869,116 (GRCm38)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,568,475 (GRCm38)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,709,921 (GRCm38)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,714,548 (GRCm38)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,676,251 (GRCm38)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,772,556 (GRCm38)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,716,977 (GRCm38)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,668,839 (GRCm38)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,705,684 (GRCm38)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,869,156 (GRCm38)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,834,095 (GRCm38)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,799,861 (GRCm38)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,638,443 (GRCm38)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,731,669 (GRCm38)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,635,559 (GRCm38)	missense	probably null
R0601:Ryr2	UTSW	13	11,705,633 (GRCm38)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,622,952 (GRCm38)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,724,333 (GRCm38)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,566,885 (GRCm38)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,554,529 (GRCm38)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,738,126 (GRCm38)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,554,529 (GRCm38)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,669,969 (GRCm38)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,945,981 (GRCm38)	missense	probably damaging	0.98
R1238:Ryr2	UTSW	13	11,759,703 (GRCm38)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,883,043 (GRCm38)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,687,879 (GRCm38)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,595,076 (GRCm38)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,714,503 (GRCm38)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,779,266 (GRCm38)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,738,149 (GRCm38)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,727,022 (GRCm38)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,601,841 (GRCm38)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,554,592 (GRCm38)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,554,549 (GRCm38)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,785,143 (GRCm38)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,759,677 (GRCm38)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,794,563 (GRCm38)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,718,482 (GRCm38)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,603,779 (GRCm38)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,731,657 (GRCm38)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,587,442 (GRCm38)	splice site	probably null
R1728:Ryr2	UTSW	13	11,587,422 (GRCm38)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,790,267 (GRCm38)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,745,176 (GRCm38)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,745,176 (GRCm38)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,700,371 (GRCm38)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,595,281 (GRCm38)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,560,586 (GRCm38)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,587,316 (GRCm38)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,769,878 (GRCm38)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,731,700 (GRCm38)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,662,075 (GRCm38)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,738,356 (GRCm38)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,658,958 (GRCm38)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,750,932 (GRCm38)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,591,336 (GRCm38)	missense	probably benign
R1909:Ryr2	UTSW	13	11,700,349 (GRCm38)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,556,698 (GRCm38)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,668,962 (GRCm38)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,731,723 (GRCm38)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,681,080 (GRCm38)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,585,402 (GRCm38)	splice site	probably null
R2018:Ryr2	UTSW	13	11,851,188 (GRCm38)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,851,188 (GRCm38)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,595,736 (GRCm38)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,665,878 (GRCm38)	splice site	probably null
R2088:Ryr2	UTSW	13	11,662,229 (GRCm38)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,712,195 (GRCm38)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,560,607 (GRCm38)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,577,873 (GRCm38)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,705,793 (GRCm38)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,810,937 (GRCm38)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,662,260 (GRCm38)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,738,216 (GRCm38)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,738,242 (GRCm38)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,591,237 (GRCm38)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,801,848 (GRCm38)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,759,703 (GRCm38)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,593,093 (GRCm38)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,593,093 (GRCm38)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,761,349 (GRCm38)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,761,349 (GRCm38)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,772,580 (GRCm38)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,588,159 (GRCm38)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,738,209 (GRCm38)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,772,427 (GRCm38)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,918,414 (GRCm38)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,692,682 (GRCm38)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,779,267 (GRCm38)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,587,437 (GRCm38)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,737,873 (GRCm38)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,750,725 (GRCm38)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,649,812 (GRCm38)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,605,233 (GRCm38)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,717,066 (GRCm38)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,735,527 (GRCm38)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,106,415 (GRCm38)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,749,509 (GRCm38)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,750,685 (GRCm38)	splice site	probably null
R4668:Ryr2	UTSW	13	11,593,117 (GRCm38)	missense	probably benign
R4677:Ryr2	UTSW	13	11,706,667 (GRCm38)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,824,369 (GRCm38)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,595,233 (GRCm38)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,692,646 (GRCm38)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,716,998 (GRCm38)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,737,753 (GRCm38)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,657,047 (GRCm38)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,687,932 (GRCm38)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,708,227 (GRCm38)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,687,932 (GRCm38)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,708,227 (GRCm38)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,717,097 (GRCm38)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,655,698 (GRCm38)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,745,752 (GRCm38)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,668,820 (GRCm38)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,752,218 (GRCm38)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,594,986 (GRCm38)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,594,986 (GRCm38)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,709,963 (GRCm38)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,945,945 (GRCm38)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,742,011 (GRCm38)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,785,080 (GRCm38)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,833,992 (GRCm38)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,714,611 (GRCm38)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,714,611 (GRCm38)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,833,992 (GRCm38)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,595,306 (GRCm38)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,643,895 (GRCm38)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,587,254 (GRCm38)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,635,536 (GRCm38)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,700,354 (GRCm38)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,712,243 (GRCm38)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,662,130 (GRCm38)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,660,289 (GRCm38)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,752,321 (GRCm38)	missense	probably benign
R5187:Ryr2	UTSW	13	11,772,452 (GRCm38)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,638,430 (GRCm38)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,772,437 (GRCm38)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,690,363 (GRCm38)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,556,658 (GRCm38)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,655,713 (GRCm38)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,705,656 (GRCm38)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,705,701 (GRCm38)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,745,601 (GRCm38)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,687,909 (GRCm38)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,555,448 (GRCm38)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,595,014 (GRCm38)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,708,202 (GRCm38)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,601,805 (GRCm38)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,595,582 (GRCm38)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,759,836 (GRCm38)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,769,962 (GRCm38)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,603,732 (GRCm38)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,560,574 (GRCm38)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,584,154 (GRCm38)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,790,332 (GRCm38)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,687,902 (GRCm38)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,660,122 (GRCm38)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,726,953 (GRCm38)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,662,238 (GRCm38)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,714,511 (GRCm38)	splice site	probably null
R6104:Ryr2	UTSW	13	11,799,825 (GRCm38)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,792,689 (GRCm38)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,669,017 (GRCm38)	missense	probably benign
R6208:Ryr2	UTSW	13	11,895,220 (GRCm38)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,834,078 (GRCm38)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,660,107 (GRCm38)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,879,496 (GRCm38)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,761,396 (GRCm38)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,662,383 (GRCm38)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,834,007 (GRCm38)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,668,821 (GRCm38)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,594,723 (GRCm38)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,710,065 (GRCm38)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,595,643 (GRCm38)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,594,723 (GRCm38)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,738,462 (GRCm38)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,686,966 (GRCm38)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,726,930 (GRCm38)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,829,654 (GRCm38)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,827,559 (GRCm38)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,745,601 (GRCm38)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,566,948 (GRCm38)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,801,243 (GRCm38)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,654,380 (GRCm38)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,712,166 (GRCm38)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,794,605 (GRCm38)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,824,400 (GRCm38)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,649,776 (GRCm38)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,669,987 (GRCm38)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,655,713 (GRCm38)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,668,811 (GRCm38)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,640,327 (GRCm38)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,810,908 (GRCm38)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,801,177 (GRCm38)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,686,978 (GRCm38)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,759,757 (GRCm38)	missense	probably benign
R7189:Ryr2	UTSW	13	11,883,123 (GRCm38)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,665,913 (GRCm38)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,597,146 (GRCm38)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,738,194 (GRCm38)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,745,631 (GRCm38)	missense	probably benign
R7365:Ryr2	UTSW	13	11,640,275 (GRCm38)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,785,111 (GRCm38)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,735,620 (GRCm38)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,556,748 (GRCm38)	splice site	probably null
R7425:Ryr2	UTSW	13	11,705,644 (GRCm38)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,555,463 (GRCm38)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,752,282 (GRCm38)	missense	probably benign
R7460:Ryr2	UTSW	13	11,705,710 (GRCm38)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,594,876 (GRCm38)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,638,431 (GRCm38)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,737,985 (GRCm38)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,799,825 (GRCm38)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,560,653 (GRCm38)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,761,327 (GRCm38)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,761,315 (GRCm38)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,690,333 (GRCm38)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,730,343 (GRCm38)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,751,011 (GRCm38)	missense	probably benign
R7797:Ryr2	UTSW	13	11,801,180 (GRCm38)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,827,607 (GRCm38)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,706,623 (GRCm38)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,595,724 (GRCm38)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,792,748 (GRCm38)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,646,427 (GRCm38)	splice site	probably null
R8008:Ryr2	UTSW	13	11,657,094 (GRCm38)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,588,140 (GRCm38)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,945,995 (GRCm38)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,603,698 (GRCm38)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,827,553 (GRCm38)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,595,506 (GRCm38)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,799,832 (GRCm38)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,668,935 (GRCm38)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,684,478 (GRCm38)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,659,008 (GRCm38)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,577,778 (GRCm38)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,560,593 (GRCm38)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,687,989 (GRCm38)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,686,947 (GRCm38)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,668,969 (GRCm38)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,735,623 (GRCm38)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,558,048 (GRCm38)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,779,266 (GRCm38)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,785,104 (GRCm38)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,799,882 (GRCm38)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,595,038 (GRCm38)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,603,732 (GRCm38)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,594,786 (GRCm38)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,738,103 (GRCm38)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,595,931 (GRCm38)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,601,838 (GRCm38)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,603,855 (GRCm38)	intron	probably benign
R9116:Ryr2	UTSW	13	11,572,299 (GRCm38)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,654,406 (GRCm38)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,885,538 (GRCm38)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,829,674 (GRCm38)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,829,674 (GRCm38)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,595,886 (GRCm38)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,883,116 (GRCm38)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,750,968 (GRCm38)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,883,090 (GRCm38)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,883,090 (GRCm38)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,706,692 (GRCm38)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,883,116 (GRCm38)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,681,087 (GRCm38)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,794,573 (GRCm38)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,772,577 (GRCm38)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,737,794 (GRCm38)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,556,604 (GRCm38)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,587,215 (GRCm38)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,745,218 (GRCm38)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,668,962 (GRCm38)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,722,760 (GRCm38)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,687,049 (GRCm38)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,594,899 (GRCm38)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,692,713 (GRCm38)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,869,156 (GRCm38)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,703,501 (GRCm38)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,643,803 (GRCm38)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,598,611 (GRCm38)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,794,549 (GRCm38)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,750,873 (GRCm38)	missense	possibly damaging	0.87

Predicted Primers

Posted On

2014-01-15