Incidental Mutation 'R1199:Slc46a2'
ID101182
Institutional Source Beutler Lab
Gene Symbol Slc46a2
Ensembl Gene ENSMUSG00000028386
Gene Namesolute carrier family 46, member 2
SynonymsLy110, TSO-1C12, 5430429N04Rik, Tscot
MMRRC Submission 039269-MU
Accession Numbers

Genbank: NM_021053

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1199 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59905126-59915056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59914189 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000030081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030081]
Predicted Effect probably benign
Transcript: ENSMUST00000030081
AA Change: T245A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030081
Gene: ENSMUSG00000028386
AA Change: T245A

DomainStartEndE-ValueType
Pfam:MFS_1 65 424 1.1e-16 PFAM
transmembrane domain 438 460 N/A INTRINSIC
Meta Mutation Damage Score 0.2362 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: About one-third of homozygotes carrying a reporter allele that results in a small deletion within exon 1 display a slight reduction in total thymocyte yield at 6 weeks of age. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Slc46a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc46a2 APN 4 59911926 nonsense probably null
G5030:Slc46a2 UTSW 4 59913867 missense probably damaging 1.00
R0008:Slc46a2 UTSW 4 59914544 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R1225:Slc46a2 UTSW 4 59914125 missense probably benign 0.01
R1389:Slc46a2 UTSW 4 59914620 missense probably damaging 1.00
R1965:Slc46a2 UTSW 4 59914249 missense probably damaging 1.00
R2334:Slc46a2 UTSW 4 59914150 missense possibly damaging 0.94
R4036:Slc46a2 UTSW 4 59913818 missense probably damaging 1.00
R4230:Slc46a2 UTSW 4 59914048 missense probably benign 0.15
R4600:Slc46a2 UTSW 4 59911886 missense probably damaging 1.00
R5851:Slc46a2 UTSW 4 59913906 missense probably damaging 1.00
R6467:Slc46a2 UTSW 4 59914077 missense probably benign 0.00
R7213:Slc46a2 UTSW 4 59914279 missense possibly damaging 0.71
R7536:Slc46a2 UTSW 4 59914141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGTCATAGATGATGGCACCCAC -3'
(R):5'- CCCGCATCGGACTCTTACTCAAAG -3'

Sequencing Primer
(F):5'- TAGATGATGGCACCCACAAACAG -3'
(R):5'- CGGACTCTTACTCAAAGTGATGC -3'
Posted On2014-01-15