Incidental Mutation 'R1167:Ipo4'
ID101187
Institutional Source Beutler Lab
Gene Symbol Ipo4
Ensembl Gene ENSMUSG00000002319
Gene Nameimportin 4
Synonyms
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55625400-55635957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55635020 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 88 (L88P)
Ref Sequence ENSEMBL: ENSMUSP00000123692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000135221] [ENSMUST00000148351] [ENSMUST00000149726]
Predicted Effect probably benign
Transcript: ENSMUST00000002391
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047131
AA Change: L88P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319
AA Change: L88P

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120041
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121791
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121937
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122358
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125133
AA Change: L91P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect probably benign
Transcript: ENSMUST00000132338
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135221
AA Change: L88P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319
AA Change: L88P

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148351
AA Change: L88P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319
AA Change: L88P

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228754
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tbc1d4 C T 14: 101,608,019 D148N probably damaging Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Ipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0277:Ipo4 UTSW 14 55632115 missense probably benign 0.03
R0344:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0467:Ipo4 UTSW 14 55635526 start codon destroyed probably null
R1217:Ipo4 UTSW 14 55634359 missense probably damaging 0.98
R1804:Ipo4 UTSW 14 55629456 missense probably damaging 1.00
R2270:Ipo4 UTSW 14 55634100 missense probably damaging 1.00
R3551:Ipo4 UTSW 14 55633103 missense probably benign 0.10
R4561:Ipo4 UTSW 14 55630089 splice site probably benign
R4801:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4802:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4804:Ipo4 UTSW 14 55630856 missense possibly damaging 0.80
R5384:Ipo4 UTSW 14 55626196 missense probably benign 0.28
R5493:Ipo4 UTSW 14 55630870 missense probably benign 0.00
R5527:Ipo4 UTSW 14 55632050 unclassified probably null
R5631:Ipo4 UTSW 14 55632069 missense probably damaging 1.00
R5631:Ipo4 UTSW 14 55633381 missense probably benign 0.08
R5788:Ipo4 UTSW 14 55628820 missense probably benign 0.02
R5929:Ipo4 UTSW 14 55631189 missense probably benign 0.03
R6018:Ipo4 UTSW 14 55626152 critical splice donor site probably null
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6707:Ipo4 UTSW 14 55628904 missense possibly damaging 0.82
R7344:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7345:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7702:Ipo4 UTSW 14 55632330 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15