Mutagenetix > Incidental Mutations

Incidental Mutation 'R1167:Tbc1d4'

101191

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d4

Ensembl Gene

ENSMUSG00000033083

Gene Name

TBC1 domain family, member 4

Synonyms

5930406J04Rik, AS160

MMRRC Submission

039240-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101442360-101609191 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101608019 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 148 (D148N)

Ref Sequence

ENSEMBL: ENSMUSP00000124909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100340
AA Change: D148N

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083
AA Change: D148N

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
low complexity region	708	720	N/A	INTRINSIC
Blast:TBC	773	834	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159484

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160297

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161991
AA Change: D148N

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: D148N

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
Pfam:DUF3350	746	809	1.2e-27	PFAM
TBC	860	1080	5.2e-77	SMART
Blast:TBC	1105	1163	1e-23	BLAST
Blast:TBC	1168	1222	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000162617
AA Change: D148N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: D148N

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
low complexity region	708	720	N/A	INTRINSIC
Pfam:DUF3350	809	872	3.3e-31	PFAM
TBC	923	1143	5.2e-77	SMART
Blast:TBC	1168	1226	2e-23	BLAST
Blast:TBC	1231	1285	1e-20	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Tbc1d4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tbc1d4	APN	14	101608112	missense	probably damaging	1.00
IGL00864:Tbc1d4	APN	14	101444566	missense	probably benign	0.23
IGL01065:Tbc1d4	APN	14	101449193	splice site	probably benign
IGL01144:Tbc1d4	APN	14	101444663	missense	probably damaging	0.99
IGL01153:Tbc1d4	APN	14	101608015	missense	possibly damaging	0.52
IGL01472:Tbc1d4	APN	14	101489864	nonsense	probably null
IGL02177:Tbc1d4	APN	14	101454939	missense	possibly damaging	0.90
IGL02259:Tbc1d4	APN	14	101465730	missense	probably damaging	1.00
IGL02938:Tbc1d4	APN	14	101501100	missense	probably damaging	1.00
IGL02975:Tbc1d4	APN	14	101458113	missense	probably damaging	1.00
R0396:Tbc1d4	UTSW	14	101458063	splice site	probably null
R0787:Tbc1d4	UTSW	14	101449209	missense	probably damaging	1.00
R0944:Tbc1d4	UTSW	14	101479220	splice site	probably benign
R1456:Tbc1d4	UTSW	14	101507106	missense	probably damaging	1.00
R1465:Tbc1d4	UTSW	14	101447688	missense	possibly damaging	0.87
R1465:Tbc1d4	UTSW	14	101447688	missense	possibly damaging	0.87
R1672:Tbc1d4	UTSW	14	101475215	missense	possibly damaging	0.92
R1762:Tbc1d4	UTSW	14	101507138	missense	possibly damaging	0.95
R2057:Tbc1d4	UTSW	14	101477155	missense	probably damaging	0.97
R2260:Tbc1d4	UTSW	14	101494411	missense	probably damaging	1.00
R2762:Tbc1d4	UTSW	14	101494361	missense	probably damaging	1.00
R3814:Tbc1d4	UTSW	14	101458755	missense	possibly damaging	0.94
R3983:Tbc1d4	UTSW	14	101507213	missense	probably benign	0.00
R4498:Tbc1d4	UTSW	14	101608336	missense	probably damaging	1.00
R4580:Tbc1d4	UTSW	14	101458783	missense	probably benign	0.00
R4664:Tbc1d4	UTSW	14	101462827	intron	probably benign
R4872:Tbc1d4	UTSW	14	101444708	missense	probably benign	0.06
R4940:Tbc1d4	UTSW	14	101507231	missense	probably benign	0.27
R4964:Tbc1d4	UTSW	14	101458174	missense	probably damaging	1.00
R4966:Tbc1d4	UTSW	14	101458174	missense	probably damaging	1.00
R5103:Tbc1d4	UTSW	14	101458882	nonsense	probably null
R5180:Tbc1d4	UTSW	14	101507572	missense	probably damaging	1.00
R5366:Tbc1d4	UTSW	14	101607976	missense	possibly damaging	0.67
R5673:Tbc1d4	UTSW	14	101455008	missense	probably damaging	1.00
R6057:Tbc1d4	UTSW	14	101489917	missense	probably damaging	0.99
R6180:Tbc1d4	UTSW	14	101458770	missense	probably benign	0.01
R6361:Tbc1d4	UTSW	14	101507174	missense	probably damaging	0.97
R6509:Tbc1d4	UTSW	14	101608318	missense	possibly damaging	0.92
R6791:Tbc1d4	UTSW	14	101608259	missense	probably damaging	0.98
R7001:Tbc1d4	UTSW	14	101458749	missense	probably benign	0.43
R7016:Tbc1d4	UTSW	14	101487441	missense	probably damaging	1.00
R7575:Tbc1d4	UTSW	14	101447589	missense	probably damaging	1.00
R7691:Tbc1d4	UTSW	14	101507641	missense	probably damaging	1.00
R7936:Tbc1d4	UTSW	14	101465754	missense	probably damaging	1.00
R7991:Tbc1d4	UTSW	14	101608279	missense	probably damaging	0.98
R8182:Tbc1d4	UTSW	14	101507554	missense	probably damaging	1.00
R8540:Tbc1d4	UTSW	14	101608276	missense	probably damaging	1.00
Z1088:Tbc1d4	UTSW	14	101452423	missense	probably damaging	1.00
Z1176:Tbc1d4	UTSW	14	101507087	critical splice donor site	probably null

Predicted Primers

Posted On

2014-01-15