Incidental Mutation 'R1167:Tbc1d4'
ID101191
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene NameTBC1 domain family, member 4
Synonyms5930406J04Rik, AS160
MMRRC Submission 039240-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1167 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location101442360-101609191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101608019 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 148 (D148N)
Ref Sequence ENSEMBL: ENSMUSP00000124909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100340
AA Change: D148N

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083
AA Change: D148N

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160297
Predicted Effect possibly damaging
Transcript: ENSMUST00000161991
AA Change: D148N

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: D148N

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162617
AA Change: D148N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: D148N

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,579 D315V probably damaging Het
4931440F15Rik C T 11: 29,823,567 R630H probably damaging Het
Acr T C 15: 89,573,974 I286T probably damaging Het
Adnp A G 2: 168,184,500 S292P probably benign Het
Apol6 T A 15: 77,047,108 Y17* probably null Het
Arhgap22 A G 14: 33,343,307 probably null Het
Bfar A G 16: 13,698,894 K202E possibly damaging Het
Bmpr2 A T 1: 59,859,304 S470C probably damaging Het
Cep135 A G 5: 76,624,637 E623G probably damaging Het
Clcn3 A G 8: 60,922,788 probably null Het
Clptm1 A T 7: 19,634,211 M523K probably damaging Het
Cyp26b1 A G 6: 84,584,330 W117R probably damaging Het
Dnmt3c T G 2: 153,711,781 probably null Het
Dst A G 1: 34,223,858 E2212G probably damaging Het
Edrf1 A G 7: 133,644,066 T238A probably benign Het
Elmo1 T C 13: 20,185,455 V10A probably damaging Het
Ermp1 A G 19: 29,628,679 S225P possibly damaging Het
Fes A T 7: 80,383,109 L296Q probably damaging Het
Foxn1 A T 11: 78,359,066 N544K probably damaging Het
Gga1 C G 15: 78,888,170 N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm4884 A T 7: 41,043,912 Q435L possibly damaging Het
Gm8444 T C 15: 81,843,380 probably benign Het
Gm8882 G A 6: 132,361,590 P222S unknown Het
Ift140 T G 17: 25,035,745 S131A probably benign Het
Ipo4 A G 14: 55,635,020 L88P probably damaging Het
Itgal G A 7: 127,300,939 S123N probably damaging Het
Kcnn3 C T 3: 89,564,952 Q344* probably null Het
Lrrc8e A T 8: 4,235,337 M521L probably benign Het
Myocd G T 11: 65,196,377 D113E possibly damaging Het
Nek4 G A 14: 30,974,345 R499H possibly damaging Het
Notch3 T C 17: 32,122,745 D2011G possibly damaging Het
Ola1 A G 2: 73,097,194 V347A probably damaging Het
Olfr1037 A G 2: 86,085,291 V162A probably benign Het
Olfr1339 C A 4: 118,734,632 F34L possibly damaging Het
Olfr790 G A 10: 129,501,150 V89I probably benign Het
Oxct2b A G 4: 123,117,585 T433A probably damaging Het
P2ry14 T C 3: 59,115,131 R312G probably damaging Het
Pbrm1 A G 14: 31,050,142 N398D probably damaging Het
Pdc T C 1: 150,333,245 Y160H probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pop4 A T 7: 38,263,269 D190E probably benign Het
R3hdm4 A G 10: 79,912,073 probably null Het
Rab1a C A 11: 20,223,172 T91K possibly damaging Het
Rad9a A G 19: 4,197,502 V215A possibly damaging Het
Rassf3 A G 10: 121,416,254 V84A probably damaging Het
Rftn2 G A 1: 55,204,299 T270M probably damaging Het
Rho A G 6: 115,935,423 T100A probably damaging Het
Rnft2 T C 5: 118,228,882 I264V possibly damaging Het
Robo3 A T 9: 37,423,907 Y567* probably null Het
Rpp14 T A 14: 8,083,705 probably null Het
Rtkn2 T C 10: 67,997,620 S98P probably damaging Het
Ryr2 A G 13: 11,660,113 V3376A possibly damaging Het
Sbf2 A T 7: 110,364,549 W1030R probably damaging Het
Setbp1 G A 18: 78,857,236 A1072V possibly damaging Het
Slc4a10 A G 2: 62,228,574 K142E probably damaging Het
Slc52a2 A G 15: 76,539,591 E40G probably benign Het
Slc8a2 A G 7: 16,157,387 N784S possibly damaging Het
Spats2l A T 1: 57,943,111 Q384L probably damaging Het
Steap4 A C 5: 7,976,520 K161T probably benign Het
Taf10 T C 7: 105,743,231 S188G probably benign Het
Tenm2 T G 11: 36,864,684 K162N probably benign Het
Tmem147 A G 7: 30,727,796 V146A probably benign Het
Tnfsf8 A G 4: 63,837,086 S100P possibly damaging Het
Trim56 T C 5: 137,112,520 Y714C probably damaging Het
Ubxn8 A G 8: 33,641,901 S13P probably damaging Het
Usp49 A G 17: 47,672,226 D52G possibly damaging Het
Vegfc A C 8: 54,186,043 Y408S probably benign Het
Vmn2r77 A G 7: 86,801,746 N280S probably benign Het
Vmn2r8 T A 5: 108,803,176 L134F probably benign Het
Wdfy3 T A 5: 101,875,931 I2437F probably benign Het
Wwc2 A T 8: 47,858,779 L783* probably null Het
Zer1 C T 2: 30,108,246 R351H probably benign Het
Zfp715 A T 7: 43,298,437 F700I possibly damaging Het
Zfp995 G A 17: 21,879,979 H425Y probably damaging Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101608112 missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101444566 missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101449193 splice site probably benign
IGL01144:Tbc1d4 APN 14 101444663 missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101608015 missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101489864 nonsense probably null
IGL02177:Tbc1d4 APN 14 101454939 missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101465730 missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101501100 missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101458113 missense probably damaging 1.00
R0396:Tbc1d4 UTSW 14 101458063 splice site probably null
R0787:Tbc1d4 UTSW 14 101449209 missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101479220 splice site probably benign
R1456:Tbc1d4 UTSW 14 101507106 missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101475215 missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101507138 missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101477155 missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101494411 missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101494361 missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101458755 missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101507213 missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101608336 missense probably damaging 1.00
R4580:Tbc1d4 UTSW 14 101458783 missense probably benign 0.00
R4664:Tbc1d4 UTSW 14 101462827 intron probably benign
R4872:Tbc1d4 UTSW 14 101444708 missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101507231 missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101458882 nonsense probably null
R5180:Tbc1d4 UTSW 14 101507572 missense probably damaging 1.00
R5366:Tbc1d4 UTSW 14 101607976 missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101455008 missense probably damaging 1.00
R6057:Tbc1d4 UTSW 14 101489917 missense probably damaging 0.99
R6180:Tbc1d4 UTSW 14 101458770 missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101507174 missense probably damaging 0.97
R6509:Tbc1d4 UTSW 14 101608318 missense possibly damaging 0.92
R6791:Tbc1d4 UTSW 14 101608259 missense probably damaging 0.98
R7001:Tbc1d4 UTSW 14 101458749 missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101487441 missense probably damaging 1.00
R7575:Tbc1d4 UTSW 14 101447589 missense probably damaging 1.00
R7691:Tbc1d4 UTSW 14 101507641 missense probably damaging 1.00
R7936:Tbc1d4 UTSW 14 101465754 missense probably damaging 1.00
R7991:Tbc1d4 UTSW 14 101608279 missense probably damaging 0.98
R8182:Tbc1d4 UTSW 14 101507554 missense probably damaging 1.00
R8540:Tbc1d4 UTSW 14 101608276 missense probably damaging 1.00
Z1088:Tbc1d4 UTSW 14 101452423 missense probably damaging 1.00
Z1176:Tbc1d4 UTSW 14 101507087 critical splice donor site probably null
Predicted Primers
Posted On2014-01-15