Incidental Mutation 'R1199:Klhdc10'
ID101198
Institutional Source Beutler Lab
Gene Symbol Klhdc10
Ensembl Gene ENSMUSG00000029775
Gene Namekelch domain containing 10
Synonyms
MMRRC Submission 039269-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R1199 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location30401868-30455179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30449494 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 185 (V185D)
Ref Sequence ENSEMBL: ENSMUSP00000145063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068240] [ENSMUST00000068259] [ENSMUST00000123494] [ENSMUST00000132581] [ENSMUST00000144272]
Predicted Effect probably damaging
Transcript: ENSMUST00000068240
AA Change: V296D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064594
Gene: ENSMUSG00000029775
AA Change: V296D

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 56 107 3.6e-7 PFAM
Pfam:Kelch_1 59 114 5.6e-8 PFAM
Pfam:Kelch_4 59 120 1.8e-7 PFAM
Pfam:Kelch_6 59 120 2.1e-8 PFAM
Pfam:Kelch_4 173 222 9.8e-9 PFAM
Pfam:Kelch_6 173 225 3.9e-9 PFAM
Pfam:Kelch_2 174 218 1.2e-7 PFAM
Pfam:Kelch_1 174 219 9.4e-8 PFAM
Kelch 239 294 4.93e0 SMART
Kelch 295 342 9.96e-4 SMART
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068259
AA Change: V325D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069669
Gene: ENSMUSG00000029775
AA Change: V325D

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 85 135 1.2e-7 PFAM
Pfam:Kelch_1 88 143 2.6e-8 PFAM
Pfam:Kelch_4 88 149 1.5e-6 PFAM
Pfam:Kelch_6 88 150 3.1e-8 PFAM
Pfam:Kelch_6 202 255 4.6e-9 PFAM
Pfam:Kelch_2 203 247 1.4e-7 PFAM
Pfam:Kelch_1 203 248 2.6e-6 PFAM
Kelch 268 323 4.93e0 SMART
Kelch 324 371 9.96e-4 SMART
low complexity region 402 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123494
SMART Domains Protein: ENSMUSP00000145442
Gene: ENSMUSG00000029775

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 1.2e-4 PFAM
Pfam:Kelch_6 62 115 5.2e-8 PFAM
Pfam:Kelch_2 63 107 1.6e-6 PFAM
Pfam:Kelch_1 63 108 3.1e-5 PFAM
Pfam:Kelch_1 116 157 2.1e-6 PFAM
Pfam:Kelch_6 116 157 8.8e-6 PFAM
Pfam:Kelch_4 122 157 3.7e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132581
AA Change: V243D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143839
Gene: ENSMUSG00000029775
AA Change: V243D

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
Pfam:Kelch_2 121 165 1.1e-6 PFAM
Pfam:Kelch_6 121 173 2.4e-8 PFAM
Pfam:Kelch_1 123 166 2.1e-5 PFAM
Pfam:Kelch_4 123 168 9.8e-5 PFAM
Kelch 186 241 1.7e-2 SMART
Kelch 242 289 3.3e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144272
AA Change: V185D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145063
Gene: ENSMUSG00000029775
AA Change: V185D

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 3.5e-4 PFAM
Pfam:Kelch_6 62 115 1.6e-7 PFAM
Pfam:Kelch_2 63 107 4.8e-6 PFAM
Pfam:Kelch_1 63 108 9.1e-5 PFAM
Kelch 128 183 1.7e-2 SMART
Kelch 184 231 3.3e-6 SMART
low complexity region 262 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150854
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Klhdc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Klhdc10 APN 6 30441934 splice site probably null
IGL02313:Klhdc10 APN 6 30439866 critical splice donor site probably null
IGL03353:Klhdc10 APN 6 30447992 splice site probably benign
PIT4378001:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R0379:Klhdc10 UTSW 6 30450670 missense possibly damaging 0.89
R0390:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R1628:Klhdc10 UTSW 6 30444462 missense probably damaging 0.98
R2243:Klhdc10 UTSW 6 30449559 missense probably damaging 1.00
R2861:Klhdc10 UTSW 6 30402140 missense unknown
R5007:Klhdc10 UTSW 6 30450641 missense probably benign 0.05
R5574:Klhdc10 UTSW 6 30439865 missense possibly damaging 0.92
R6428:Klhdc10 UTSW 6 30439856 missense probably damaging 1.00
R6724:Klhdc10 UTSW 6 30446641 missense probably damaging 0.99
R6842:Klhdc10 UTSW 6 30439782 missense probably damaging 1.00
R6879:Klhdc10 UTSW 6 30449590 missense probably damaging 1.00
R7014:Klhdc10 UTSW 6 30450503 missense probably damaging 1.00
R7124:Klhdc10 UTSW 6 30441827 missense probably damaging 1.00
R7453:Klhdc10 UTSW 6 30447990 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGGAGAGCCTTGCCATGAAGCC -3'
(R):5'- AAACTTGGATGTGACTGTGTTTCCCTC -3'

Sequencing Primer
(F):5'- ATGAAGCCTCCTTGGGCTG -3'
(R):5'- GCTATAAGCAACTCTTCCCTGAC -3'
Posted On2014-01-15