Mutagenetix > Incidental Mutations

Incidental Mutation 'R1167:Acr'

101207

Institutional Source

Beutler Lab

Gene Symbol

Acr

Ensembl Gene

ENSMUSG00000022622

Gene Name

acrosin prepropeptide

Synonyms

preproacrosin

MMRRC Submission

039240-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89568326-89574585 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89573974 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 286 (I286T)

Ref Sequence

ENSEMBL: ENSMUSP00000023295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023295]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023295
AA Change: I286T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: I286T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Tryp_SPc	42	286	6.84e-91	SMART
low complexity region	300	311	N/A	INTRINSIC
low complexity region	329	364	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000230538

Predicted Effect

probably benign
Transcript: ENSMUST00000230978

Predicted Effect

probably benign
Transcript: ENSMUST00000231216

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gga1	C	G	15: 78,888,170	N223K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Acr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Acr	APN	15	89573250	missense	probably benign	0.19
IGL00857:Acr	APN	15	89570002	missense	probably benign	0.00
IGL01353:Acr	APN	15	89569492	missense	probably damaging	1.00
IGL01466:Acr	APN	15	89573994	missense	probably benign
IGL01599:Acr	APN	15	89568414	missense	probably benign	0.01
IGL02408:Acr	APN	15	89570014	missense	probably damaging	1.00
R0042:Acr	UTSW	15	89574332	missense	probably benign
R0398:Acr	UTSW	15	89573941	missense	probably damaging	1.00
R0520:Acr	UTSW	15	89573227	missense	probably damaging	1.00
R0578:Acr	UTSW	15	89569475	missense	probably damaging	1.00
R0579:Acr	UTSW	15	89569475	missense	probably damaging	1.00
R1792:Acr	UTSW	15	89573143	missense	probably benign	0.00
R2006:Acr	UTSW	15	89574201	missense	probably benign	0.00
R5531:Acr	UTSW	15	89573943	missense	probably damaging	1.00
R5577:Acr	UTSW	15	89574238	missense	probably benign	0.01
R7033:Acr	UTSW	15	89569500	missense	probably benign	0.03
R7206:Acr	UTSW	15	89574171	missense	probably benign
R7484:Acr	UTSW	15	89573224	missense	probably damaging	0.99
R7548:Acr	UTSW	15	89574393	missense	possibly damaging	0.72
R8001:Acr	UTSW	15	89573962	missense	probably damaging	1.00
Z1177:Acr	UTSW	15	89569879	missense	possibly damaging	0.89

Predicted Primers

Posted On

2014-01-15