Incidental Mutation 'R1199:Ftcd'
ID101218
Institutional Source Beutler Lab
Gene Symbol Ftcd
Ensembl Gene ENSMUSG00000001155
Gene Nameformiminotransferase cyclodeaminase
Synonymsglutamate formiminotransferase
MMRRC Submission 039269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1199 (G1)
Quality Score206
Status Validated
Chromosome10
Chromosomal Location76575648-76590338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76579819 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 135 (R135H)
Ref Sequence ENSEMBL: ENSMUSP00000001183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001183]
Predicted Effect probably damaging
Transcript: ENSMUST00000001183
AA Change: R135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001183
Gene: ENSMUSG00000001155
AA Change: R135H

DomainStartEndE-ValueType
FTCD_N 3 180 1.6e-120 SMART
FTCD 181 325 6.92e-93 SMART
Pfam:FTCD_C 339 520 1.3e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137347
Meta Mutation Damage Score 0.2333 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that channels 1-carbon units from formiminoglutamate, a metabolite of the histidine degradation pathway, to the folate pool. Mutations in this gene are associated with glutamate formiminotransferase deficiency. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Ftcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Ftcd APN 10 76584587 missense probably benign 0.03
IGL01683:Ftcd APN 10 76580129 missense probably damaging 1.00
IGL02478:Ftcd APN 10 76581421 nonsense probably null
IGL02664:Ftcd APN 10 76584605 missense probably damaging 0.98
IGL03077:Ftcd APN 10 76581627 missense probably damaging 0.99
R1771:Ftcd UTSW 10 76587368 missense probably damaging 0.98
R1876:Ftcd UTSW 10 76581569 missense probably benign 0.26
R2260:Ftcd UTSW 10 76588059 splice site probably null
R2386:Ftcd UTSW 10 76581377 missense probably damaging 1.00
R4578:Ftcd UTSW 10 76589258 missense probably benign
R4951:Ftcd UTSW 10 76584683 missense probably benign 0.15
R5479:Ftcd UTSW 10 76578016 missense probably benign 0.00
R5524:Ftcd UTSW 10 76589331 utr 3 prime probably benign
R5567:Ftcd UTSW 10 76588133 missense probably benign 0.20
R5655:Ftcd UTSW 10 76588103 missense probably damaging 1.00
R6776:Ftcd UTSW 10 76589239 missense probably benign 0.09
R7449:Ftcd UTSW 10 76580163 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTTTTGGGTAAGCCAGAGGCATC -3'
(R):5'- CTCCCGCAGGTTAAGAGCAATACG -3'

Sequencing Primer
(F):5'- GCCAGAGGCATCTGAATTGC -3'
(R):5'- CAATGAGGAACTTCCGTGC -3'
Posted On2014-01-15