Mutagenetix > Incidental Mutation

Incidental Mutation 'R1199:Gm5174'

101220

Institutional Source

Beutler Lab

Gene Symbol

Gm5174

Ensembl Gene

ENSMUSG00000090308

Gene Name

predicted gene 5174

Synonyms

MMRRC Submission

039269-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R1199 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86655939-86657381 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 86657325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171131

SMART Domains

Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

Domain	Start	End	E-Value	Type
S_TKc	14	262	5.59e-86	SMART
UBA	276	313	1.28e-3	SMART
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219608

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

96% (55/57)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	T	9: 108,393,477	H80L	possibly damaging	Het
A1bg	A	T	15: 60,919,635		probably null	Het
Aco2	C	T	15: 81,895,193	S33L	probably damaging	Het
Agrn	T	A	4: 156,172,299	Y1283F	probably benign	Het
Akap6	T	C	12: 52,796,190	V107A	probably damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Btnl9	A	T	11: 49,180,747	V83E	probably damaging	Het
Camk2a	T	A	18: 60,952,324	C131*	probably null	Het
Ccdc14	C	T	16: 34,723,828	T852M	probably damaging	Het
Cntn4	T	C	6: 106,353,597		probably benign	Het
Cp	T	G	3: 19,977,152	S585R	probably damaging	Het
Cpt1b	G	A	15: 89,419,010	A614V	probably benign	Het
Crygn	T	C	5: 24,751,148	Y153C	probably damaging	Het
Dennd1a	A	T	2: 37,961,716	D53E	probably damaging	Het
Deptor	T	C	15: 55,252,010	C357R	probably benign	Het
Dnajc28	C	A	16: 91,618,642		probably benign	Het
Eml6	G	A	11: 29,755,044	A1500V	possibly damaging	Het
Fgd5	T	A	6: 91,986,978	L64Q	possibly damaging	Het
Fgfbp1	A	G	5: 43,979,597	Y118H	probably damaging	Het
Ftcd	G	A	10: 76,579,819	R135H	probably damaging	Het
Gpr37l1	A	T	1: 135,166,972	L178Q	probably damaging	Het
Gtf2ird1	A	G	5: 134,411,064	V104A	possibly damaging	Het
Irs1	T	A	1: 82,289,626	S290C	probably damaging	Het
Kel	C	T	6: 41,688,591	V532I	possibly damaging	Het
Kif1c	A	G	11: 70,708,601	E442G	possibly damaging	Het
Klhdc10	T	A	6: 30,449,494	V185D	probably damaging	Het
Lpp	C	T	16: 24,681,860	R141C	probably damaging	Het
Olfr1025-ps1	A	G	2: 85,918,035	I37V	probably benign	Het
Olfr68	A	T	7: 103,777,985	M120K	probably damaging	Het
Pcnx2	G	T	8: 125,887,314	P466H	possibly damaging	Het
Pcsk1	A	T	13: 75,096,413		probably benign	Het
Pkd2l2	T	C	18: 34,438,216		probably null	Het
Pomt1	A	G	2: 32,250,492	N454S	probably benign	Het
Samhd1	A	T	2: 157,109,461	I452N	probably damaging	Het
Sez6	A	G	11: 77,953,885	Q178R	probably benign	Het
Slc25a44	A	G	3: 88,420,986	V66A	probably damaging	Het
Slc46a2	T	C	4: 59,914,189	T245A	probably benign	Het
Slc4a4	G	A	5: 89,215,794		probably null	Het
Spata6	T	A	4: 111,799,145	C329S	possibly damaging	Het
Srrm2	A	T	17: 23,817,751		probably benign	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Svil	T	A	18: 5,059,217		probably benign	Het
Tenm3	G	T	8: 48,235,582	S2323R	probably damaging	Het
Tsc1	G	A	2: 28,665,626	R245Q	probably damaging	Het
Ttn	A	G	2: 76,908,756	V3813A	probably benign	Het
Ttn	G	A	2: 76,950,044	T1121M	possibly damaging	Het
Ush2a	G	A	1: 188,759,795	V3094I	probably benign	Het
Vcan	A	G	13: 89,679,794		probably null	Het
Vmn1r189	A	T	13: 22,102,658	L3Q	probably damaging	Het
Vmn1r60	A	C	7: 5,544,972	V43G	probably damaging	Het
Vmn2r110	A	G	17: 20,583,263	I350T	probably benign	Het
Vmn2r86	T	A	10: 130,448,574		probably benign	Het
Xrn1	A	G	9: 95,981,761		probably benign	Het
Zfp251	C	T	15: 76,854,236	R219Q	possibly damaging	Het

Other mutations in Gm5174

Allele	Source	Chr	Coord	Type	Predicted Effect
Laco	UTSW	10	86656108	unclassified	noncoding transcript
R1083:Gm5174	UTSW	10	86656108	unclassified	noncoding transcript
R1296:Gm5174	UTSW	10	86657002	unclassified	noncoding transcript
R1715:Gm5174	UTSW	10	86656912	unclassified	noncoding transcript
R1957:Gm5174	UTSW	10	86656753	unclassified	noncoding transcript
R2221:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R2223:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R3104:Gm5174	UTSW	10	86656655	unclassified	noncoding transcript
R4165:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4166:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4243:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R4244:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R5024:Gm5174	UTSW	10	86656587	unclassified	noncoding transcript
R5292:Gm5174	UTSW	10	86656698	unclassified	noncoding transcript
R5586:Gm5174	UTSW	10	86656545	unclassified	noncoding transcript
R5864:Gm5174	UTSW	10	86657181	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGAGAAGAAGAGCACCACTCCTAGC -3'
(R):5'- TTCAGCATGGATGACCCCTTTCAC -3'

Sequencing Primer
(F):5'- CTGTGCCATCTATACCGGAG -3'
(R):5'- CCTGCTGGAGTAGATATACACCTG -3'

Posted On

2014-01-15