Incidental Mutation 'R1167:Setbp1'
ID 101221
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
MMRRC Submission 039240-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.625) question?
Stock # R1167 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 78793595-79152606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78900451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1072 (A1072V)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect possibly damaging
Transcript: ENSMUST00000025430
AA Change: A1072V

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: A1072V

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161465
AA Change: A1072V

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: A1072V

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,643,003 (GRCm39) D315V probably damaging Het
Acr T C 15: 89,458,177 (GRCm39) I286T probably damaging Het
Adnp A G 2: 168,026,420 (GRCm39) S292P probably benign Het
Apol6 T A 15: 76,931,308 (GRCm39) Y17* probably null Het
Arhgap22 A G 14: 33,065,264 (GRCm39) probably null Het
Bfar A G 16: 13,516,758 (GRCm39) K202E possibly damaging Het
Bmpr2 A T 1: 59,898,463 (GRCm39) S470C probably damaging Het
Cep135 A G 5: 76,772,484 (GRCm39) E623G probably damaging Het
Clcn3 A G 8: 61,375,822 (GRCm39) probably null Het
Clptm1 A T 7: 19,368,136 (GRCm39) M523K probably damaging Het
Cyp26b1 A G 6: 84,561,312 (GRCm39) W117R probably damaging Het
Dnmt3c T G 2: 153,553,701 (GRCm39) probably null Het
Dst A G 1: 34,262,939 (GRCm39) E2212G probably damaging Het
Edrf1 A G 7: 133,245,795 (GRCm39) T238A probably benign Het
Elmo1 T C 13: 20,369,625 (GRCm39) V10A probably damaging Het
Ermp1 A G 19: 29,606,079 (GRCm39) S225P possibly damaging Het
Fem1al C T 11: 29,773,567 (GRCm39) R630H probably damaging Het
Fes A T 7: 80,032,857 (GRCm39) L296Q probably damaging Het
Foxn1 A T 11: 78,249,892 (GRCm39) N544K probably damaging Het
Gga1 C G 15: 78,772,370 (GRCm39) N223K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm4884 A T 7: 40,693,336 (GRCm39) Q435L possibly damaging Het
Gm8444 T C 15: 81,727,581 (GRCm39) probably benign Het
Ift140 T G 17: 25,254,719 (GRCm39) S131A probably benign Het
Ipo4 A G 14: 55,872,477 (GRCm39) L88P probably damaging Het
Itgal G A 7: 126,900,111 (GRCm39) S123N probably damaging Het
Kcnn3 C T 3: 89,472,259 (GRCm39) Q344* probably null Het
Lrrc8e A T 8: 4,285,337 (GRCm39) M521L probably benign Het
Myocd G T 11: 65,087,203 (GRCm39) D113E possibly damaging Het
Nek4 G A 14: 30,696,302 (GRCm39) R499H possibly damaging Het
Notch3 T C 17: 32,341,719 (GRCm39) D2011G possibly damaging Het
Ola1 A G 2: 72,927,538 (GRCm39) V347A probably damaging Het
Or13p5 C A 4: 118,591,829 (GRCm39) F34L possibly damaging Het
Or6c75 G A 10: 129,337,019 (GRCm39) V89I probably benign Het
Or8u10 A G 2: 85,915,635 (GRCm39) V162A probably benign Het
Oxct2b A G 4: 123,011,378 (GRCm39) T433A probably damaging Het
P2ry14 T C 3: 59,022,552 (GRCm39) R312G probably damaging Het
Pbrm1 A G 14: 30,772,099 (GRCm39) N398D probably damaging Het
Pdc T C 1: 150,208,996 (GRCm39) Y160H probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pop4 A T 7: 37,962,693 (GRCm39) D190E probably benign Het
Prb1c G A 6: 132,338,553 (GRCm39) P222S unknown Het
R3hdm4 A G 10: 79,747,907 (GRCm39) probably null Het
Rab1a C A 11: 20,173,172 (GRCm39) T91K possibly damaging Het
Rad9a A G 19: 4,247,501 (GRCm39) V215A possibly damaging Het
Rassf3 A G 10: 121,252,159 (GRCm39) V84A probably damaging Het
Rftn2 G A 1: 55,243,458 (GRCm39) T270M probably damaging Het
Rho A G 6: 115,912,384 (GRCm39) T100A probably damaging Het
Rnft2 T C 5: 118,366,947 (GRCm39) I264V possibly damaging Het
Robo3 A T 9: 37,335,203 (GRCm39) Y567* probably null Het
Rpp14 T A 14: 8,083,705 (GRCm38) probably null Het
Rtkn2 T C 10: 67,833,450 (GRCm39) S98P probably damaging Het
Ryr2 A G 13: 11,674,999 (GRCm39) V3376A possibly damaging Het
Sbf2 A T 7: 109,963,756 (GRCm39) W1030R probably damaging Het
Slc4a10 A G 2: 62,058,918 (GRCm39) K142E probably damaging Het
Slc52a2 A G 15: 76,423,791 (GRCm39) E40G probably benign Het
Slc8a2 A G 7: 15,891,312 (GRCm39) N784S possibly damaging Het
Spats2l A T 1: 57,982,270 (GRCm39) Q384L probably damaging Het
Steap4 A C 5: 8,026,520 (GRCm39) K161T probably benign Het
Taf10 T C 7: 105,392,438 (GRCm39) S188G probably benign Het
Tbc1d4 C T 14: 101,845,455 (GRCm39) D148N probably damaging Het
Tenm2 T G 11: 36,755,511 (GRCm39) K162N probably benign Het
Tmem147 A G 7: 30,427,221 (GRCm39) V146A probably benign Het
Tnfsf8 A G 4: 63,755,323 (GRCm39) S100P possibly damaging Het
Trim56 T C 5: 137,141,374 (GRCm39) Y714C probably damaging Het
Ubxn8 A G 8: 34,131,929 (GRCm39) S13P probably damaging Het
Usp49 A G 17: 47,983,151 (GRCm39) D52G possibly damaging Het
Vegfc A C 8: 54,639,078 (GRCm39) Y408S probably benign Het
Vmn2r77 A G 7: 86,450,954 (GRCm39) N280S probably benign Het
Vmn2r8 T A 5: 108,951,042 (GRCm39) L134F probably benign Het
Wdfy3 T A 5: 102,023,797 (GRCm39) I2437F probably benign Het
Wwc2 A T 8: 48,311,814 (GRCm39) L783* probably null Het
Zer1 C T 2: 29,998,258 (GRCm39) R351H probably benign Het
Zfp715 A T 7: 42,947,861 (GRCm39) F700I possibly damaging Het
Zfp995 G A 17: 22,098,960 (GRCm39) H425Y probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78,798,894 (GRCm39) nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78,900,985 (GRCm39) missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78,899,992 (GRCm39) missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78,900,625 (GRCm39) missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78,900,514 (GRCm39) missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78,900,688 (GRCm39) missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78,798,925 (GRCm39) missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78,900,589 (GRCm39) nonsense probably null
IGL03005:Setbp1 APN 18 78,902,340 (GRCm39) missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78,900,224 (GRCm39) missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78,900,841 (GRCm39) missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78,901,075 (GRCm39) missense probably damaging 1.00
R1221:Setbp1 UTSW 18 78,899,798 (GRCm39) missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78,901,423 (GRCm39) missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78,826,573 (GRCm39) missense probably benign 0.00
R1481:Setbp1 UTSW 18 78,826,516 (GRCm39) missense probably benign 0.01
R1482:Setbp1 UTSW 18 79,130,050 (GRCm39) missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78,903,127 (GRCm39) missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78,901,807 (GRCm39) missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78,901,682 (GRCm39) missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78,900,613 (GRCm39) missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78,901,577 (GRCm39) missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78,901,759 (GRCm39) missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78,899,935 (GRCm39) missense probably benign 0.00
R2851:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2853:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2941:Setbp1 UTSW 18 78,901,412 (GRCm39) missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78,900,650 (GRCm39) missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78,902,518 (GRCm39) missense probably benign 0.00
R3807:Setbp1 UTSW 18 78,826,537 (GRCm39) missense probably benign 0.01
R4133:Setbp1 UTSW 18 78,900,206 (GRCm39) missense probably benign 0.05
R4287:Setbp1 UTSW 18 78,902,276 (GRCm39) missense probably benign 0.03
R4345:Setbp1 UTSW 18 79,129,794 (GRCm39) missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78,899,833 (GRCm39) missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79,129,896 (GRCm39) missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79,130,164 (GRCm39) missense probably benign 0.00
R4595:Setbp1 UTSW 18 78,900,731 (GRCm39) missense probably benign 0.00
R4817:Setbp1 UTSW 18 78,902,015 (GRCm39) missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78,901,382 (GRCm39) missense probably benign 0.07
R4976:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78,899,809 (GRCm39) missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78,900,514 (GRCm39) missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78,900,697 (GRCm39) missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78,901,214 (GRCm39) missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78,900,190 (GRCm39) missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78,901,278 (GRCm39) missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79,129,867 (GRCm39) missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78,900,700 (GRCm39) missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78,899,860 (GRCm39) missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78,899,697 (GRCm39) splice site probably null
R5940:Setbp1 UTSW 18 78,798,703 (GRCm39) missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78,902,455 (GRCm39) missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6250:Setbp1 UTSW 18 78,901,217 (GRCm39) missense probably benign 0.00
R6256:Setbp1 UTSW 18 78,900,472 (GRCm39) missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78,826,584 (GRCm39) missense probably benign 0.21
R6522:Setbp1 UTSW 18 78,900,605 (GRCm39) missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78,902,774 (GRCm39) missense probably benign 0.00
R6886:Setbp1 UTSW 18 78,900,715 (GRCm39) missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78,901,054 (GRCm39) missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79,130,070 (GRCm39) missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79,130,175 (GRCm39) missense probably benign 0.08
R7134:Setbp1 UTSW 18 78,902,734 (GRCm39) missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78,900,052 (GRCm39) missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78,798,960 (GRCm39) missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78,900,701 (GRCm39) missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.06
R7589:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.01
R7840:Setbp1 UTSW 18 78,826,639 (GRCm39) missense probably benign 0.03
R7849:Setbp1 UTSW 18 78,900,068 (GRCm39) missense probably benign 0.00
R8147:Setbp1 UTSW 18 78,900,015 (GRCm39) missense probably damaging 1.00
R8354:Setbp1 UTSW 18 78,900,598 (GRCm39) missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78,900,971 (GRCm39) missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78,901,969 (GRCm39) missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78,826,542 (GRCm39) missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78,901,516 (GRCm39) missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78,899,723 (GRCm39) missense probably benign 0.00
R8983:Setbp1 UTSW 18 78,902,459 (GRCm39) missense probably benign 0.37
R9062:Setbp1 UTSW 18 78,900,266 (GRCm39) missense probably benign 0.01
R9113:Setbp1 UTSW 18 78,900,948 (GRCm39) missense probably damaging 0.99
R9364:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9513:Setbp1 UTSW 18 78,899,781 (GRCm39) missense probably damaging 1.00
R9517:Setbp1 UTSW 18 78,901,322 (GRCm39) missense probably damaging 0.99
R9549:Setbp1 UTSW 18 78,902,629 (GRCm39) missense probably benign 0.07
R9554:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9680:Setbp1 UTSW 18 78,902,498 (GRCm39) missense probably benign
R9711:Setbp1 UTSW 18 78,900,142 (GRCm39) missense probably benign 0.30
Z1088:Setbp1 UTSW 18 78,902,809 (GRCm39) missense probably damaging 0.98
Predicted Primers
Posted On 2014-01-15