Incidental Mutation 'R1199:Amph'
ID 101233
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Name amphiphysin
Synonyms
MMRRC Submission 039269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock # R1199 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 18948205-19150921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19142028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 643 (V643M)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
AlphaFold Q7TQF7
Predicted Effect probably benign
Transcript: ENSMUST00000003345
AA Change: V639M

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: V639M

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197545
Predicted Effect probably damaging
Transcript: ENSMUST00000200466
AA Change: V643M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: V643M

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222698
Meta Mutation Damage Score 0.2469 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,393,477 H80L possibly damaging Het
A1bg A T 15: 60,919,635 probably null Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Agrn T A 4: 156,172,299 Y1283F probably benign Het
Akap6 T C 12: 52,796,190 V107A probably damaging Het
Btnl9 A T 11: 49,180,747 V83E probably damaging Het
Camk2a T A 18: 60,952,324 C131* probably null Het
Ccdc14 C T 16: 34,723,828 T852M probably damaging Het
Cntn4 T C 6: 106,353,597 probably benign Het
Cp T G 3: 19,977,152 S585R probably damaging Het
Cpt1b G A 15: 89,419,010 A614V probably benign Het
Crygn T C 5: 24,751,148 Y153C probably damaging Het
Dennd1a A T 2: 37,961,716 D53E probably damaging Het
Deptor T C 15: 55,252,010 C357R probably benign Het
Dnajc28 C A 16: 91,618,642 probably benign Het
Eml6 G A 11: 29,755,044 A1500V possibly damaging Het
Fgd5 T A 6: 91,986,978 L64Q possibly damaging Het
Fgfbp1 A G 5: 43,979,597 Y118H probably damaging Het
Ftcd G A 10: 76,579,819 R135H probably damaging Het
Gm5174 A T 10: 86,657,325 noncoding transcript Het
Gpr37l1 A T 1: 135,166,972 L178Q probably damaging Het
Gtf2ird1 A G 5: 134,411,064 V104A possibly damaging Het
Irs1 T A 1: 82,289,626 S290C probably damaging Het
Kel C T 6: 41,688,591 V532I possibly damaging Het
Kif1c A G 11: 70,708,601 E442G possibly damaging Het
Klhdc10 T A 6: 30,449,494 V185D probably damaging Het
Lpp C T 16: 24,681,860 R141C probably damaging Het
Olfr1025-ps1 A G 2: 85,918,035 I37V probably benign Het
Olfr68 A T 7: 103,777,985 M120K probably damaging Het
Pcnx2 G T 8: 125,887,314 P466H possibly damaging Het
Pcsk1 A T 13: 75,096,413 probably benign Het
Pkd2l2 T C 18: 34,438,216 probably null Het
Pomt1 A G 2: 32,250,492 N454S probably benign Het
Samhd1 A T 2: 157,109,461 I452N probably damaging Het
Sez6 A G 11: 77,953,885 Q178R probably benign Het
Slc25a44 A G 3: 88,420,986 V66A probably damaging Het
Slc46a2 T C 4: 59,914,189 T245A probably benign Het
Slc4a4 G A 5: 89,215,794 probably null Het
Spata6 T A 4: 111,799,145 C329S possibly damaging Het
Srrm2 A T 17: 23,817,751 probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Svil T A 18: 5,059,217 probably benign Het
Tenm3 G T 8: 48,235,582 S2323R probably damaging Het
Tsc1 G A 2: 28,665,626 R245Q probably damaging Het
Ttn A G 2: 76,908,756 V3813A probably benign Het
Ttn G A 2: 76,950,044 T1121M possibly damaging Het
Ush2a G A 1: 188,759,795 V3094I probably benign Het
Vcan A G 13: 89,679,794 probably null Het
Vmn1r189 A T 13: 22,102,658 L3Q probably damaging Het
Vmn1r60 A C 7: 5,544,972 V43G probably damaging Het
Vmn2r110 A G 17: 20,583,263 I350T probably benign Het
Vmn2r86 T A 10: 130,448,574 probably benign Het
Xrn1 A G 9: 95,981,761 probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19120606 missense probably damaging 1.00
IGL01866:Amph APN 13 19142002 missense probably damaging 1.00
IGL02157:Amph APN 13 19104231 missense possibly damaging 0.60
IGL02300:Amph APN 13 19086604 missense probably damaging 1.00
IGL02435:Amph APN 13 19139163 splice site probably benign
IGL03060:Amph APN 13 19094814 missense probably damaging 0.99
IGL03122:Amph APN 13 19102943 missense probably damaging 0.98
R0037:Amph UTSW 13 19100653 missense possibly damaging 0.90
R0646:Amph UTSW 13 19113116 missense possibly damaging 0.95
R0652:Amph UTSW 13 19086621 splice site probably null
R1005:Amph UTSW 13 19142028 missense probably damaging 0.97
R1006:Amph UTSW 13 19142028 missense probably damaging 0.97
R1200:Amph UTSW 13 19142028 missense probably damaging 0.97
R1201:Amph UTSW 13 19142028 missense probably damaging 0.97
R1333:Amph UTSW 13 19142028 missense probably damaging 0.97
R1334:Amph UTSW 13 19142028 missense probably damaging 0.97
R1335:Amph UTSW 13 19142028 missense probably damaging 0.97
R1337:Amph UTSW 13 19142028 missense probably damaging 0.97
R1338:Amph UTSW 13 19142028 missense probably damaging 0.97
R1384:Amph UTSW 13 19142028 missense probably damaging 0.97
R1397:Amph UTSW 13 19142028 missense probably damaging 0.97
R1501:Amph UTSW 13 19104291 nonsense probably null
R1528:Amph UTSW 13 19142028 missense probably damaging 0.97
R1822:Amph UTSW 13 18948455 missense probably damaging 0.98
R2004:Amph UTSW 13 19142028 missense probably damaging 0.97
R2006:Amph UTSW 13 19142028 missense probably damaging 0.97
R2061:Amph UTSW 13 19125035 nonsense probably null
R2111:Amph UTSW 13 19116266 splice site probably benign
R2329:Amph UTSW 13 19139350 missense probably benign
R2878:Amph UTSW 13 19104267 missense possibly damaging 0.95
R3121:Amph UTSW 13 19113146 nonsense probably null
R3548:Amph UTSW 13 19102959 missense probably damaging 1.00
R4059:Amph UTSW 13 19141998 missense probably damaging 1.00
R4369:Amph UTSW 13 19137700 missense probably benign 0.20
R4492:Amph UTSW 13 19149758 missense possibly damaging 0.76
R4855:Amph UTSW 13 19084208 missense probably damaging 1.00
R4937:Amph UTSW 13 19104345 missense probably damaging 1.00
R4965:Amph UTSW 13 19137699 missense probably benign 0.12
R5777:Amph UTSW 13 19046016 missense probably damaging 1.00
R5787:Amph UTSW 13 18948454 missense possibly damaging 0.75
R6091:Amph UTSW 13 19125123 missense probably benign 0.01
R7100:Amph UTSW 13 19149841 makesense probably null
R7103:Amph UTSW 13 19149738 missense probably benign 0.00
R7451:Amph UTSW 13 19077368 missense probably damaging 1.00
R7522:Amph UTSW 13 19086545 missense probably damaging 0.96
R8165:Amph UTSW 13 19094837 missense probably benign 0.05
R8166:Amph UTSW 13 18948490 missense possibly damaging 0.91
R8214:Amph UTSW 13 19104298 missense possibly damaging 0.81
R9021:Amph UTSW 13 19099901 missense probably benign 0.35
R9241:Amph UTSW 13 19094802 missense probably damaging 1.00
V1662:Amph UTSW 13 19139370 missense probably benign 0.36
Z1177:Amph UTSW 13 19139334 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CCACTCCCACAAATGAATCTCTGCT -3'
(R):5'- CGGATGGAGTCCTGAATGTGCAA -3'

Sequencing Primer
(F):5'- ccttccttccttccttcctttc -3'
(R):5'- AATCACTTGTCCAGCTGACC -3'
Posted On 2014-01-15