Mutagenetix > Incidental Mutations

Incidental Mutation 'R1199:Amph'

101233

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

039269-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R1199 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19142028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 643 (V643M)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

probably benign
Transcript: ENSMUST00000003345
AA Change: V639M

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: V639M

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197545

Predicted Effect

probably damaging
Transcript: ENSMUST00000200466
AA Change: V643M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: V643M

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222698

Meta Mutation Damage Score

0.2469

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	T	9: 108,393,477	H80L	possibly damaging	Het
A1bg	A	T	15: 60,919,635		probably null	Het
Aco2	C	T	15: 81,895,193	S33L	probably damaging	Het
Agrn	T	A	4: 156,172,299	Y1283F	probably benign	Het
Akap6	T	C	12: 52,796,190	V107A	probably damaging	Het
Btnl9	A	T	11: 49,180,747	V83E	probably damaging	Het
Camk2a	T	A	18: 60,952,324	C131*	probably null	Het
Ccdc14	C	T	16: 34,723,828	T852M	probably damaging	Het
Cntn4	T	C	6: 106,353,597		probably benign	Het
Cp	T	G	3: 19,977,152	S585R	probably damaging	Het
Cpt1b	G	A	15: 89,419,010	A614V	probably benign	Het
Crygn	T	C	5: 24,751,148	Y153C	probably damaging	Het
Dennd1a	A	T	2: 37,961,716	D53E	probably damaging	Het
Deptor	T	C	15: 55,252,010	C357R	probably benign	Het
Dnajc28	C	A	16: 91,618,642		probably benign	Het
Eml6	G	A	11: 29,755,044	A1500V	possibly damaging	Het
Fgd5	T	A	6: 91,986,978	L64Q	possibly damaging	Het
Fgfbp1	A	G	5: 43,979,597	Y118H	probably damaging	Het
Ftcd	G	A	10: 76,579,819	R135H	probably damaging	Het
Gm5174	A	T	10: 86,657,325		noncoding transcript	Het
Gpr37l1	A	T	1: 135,166,972	L178Q	probably damaging	Het
Gtf2ird1	A	G	5: 134,411,064	V104A	possibly damaging	Het
Irs1	T	A	1: 82,289,626	S290C	probably damaging	Het
Kel	C	T	6: 41,688,591	V532I	possibly damaging	Het
Kif1c	A	G	11: 70,708,601	E442G	possibly damaging	Het
Klhdc10	T	A	6: 30,449,494	V185D	probably damaging	Het
Lpp	C	T	16: 24,681,860	R141C	probably damaging	Het
Olfr1025-ps1	A	G	2: 85,918,035	I37V	probably benign	Het
Olfr68	A	T	7: 103,777,985	M120K	probably damaging	Het
Pcnx2	G	T	8: 125,887,314	P466H	possibly damaging	Het
Pcsk1	A	T	13: 75,096,413		probably benign	Het
Pkd2l2	T	C	18: 34,438,216		probably null	Het
Pomt1	A	G	2: 32,250,492	N454S	probably benign	Het
Samhd1	A	T	2: 157,109,461	I452N	probably damaging	Het
Sez6	A	G	11: 77,953,885	Q178R	probably benign	Het
Slc25a44	A	G	3: 88,420,986	V66A	probably damaging	Het
Slc46a2	T	C	4: 59,914,189	T245A	probably benign	Het
Slc4a4	G	A	5: 89,215,794		probably null	Het
Spata6	T	A	4: 111,799,145	C329S	possibly damaging	Het
Srrm2	A	T	17: 23,817,751		probably benign	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Svil	T	A	18: 5,059,217		probably benign	Het
Tenm3	G	T	8: 48,235,582	S2323R	probably damaging	Het
Tsc1	G	A	2: 28,665,626	R245Q	probably damaging	Het
Ttn	A	G	2: 76,908,756	V3813A	probably benign	Het
Ttn	G	A	2: 76,950,044	T1121M	possibly damaging	Het
Ush2a	G	A	1: 188,759,795	V3094I	probably benign	Het
Vcan	A	G	13: 89,679,794		probably null	Het
Vmn1r189	A	T	13: 22,102,658	L3Q	probably damaging	Het
Vmn1r60	A	C	7: 5,544,972	V43G	probably damaging	Het
Vmn2r110	A	G	17: 20,583,263	I350T	probably benign	Het
Vmn2r86	T	A	10: 130,448,574		probably benign	Het
Xrn1	A	G	9: 95,981,761		probably benign	Het
Zfp251	C	T	15: 76,854,236	R219Q	possibly damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CCACTCCCACAAATGAATCTCTGCT -3'
(R):5'- CGGATGGAGTCCTGAATGTGCAA -3'

Sequencing Primer
(F):5'- ccttccttccttccttcctttc -3'
(R):5'- AATCACTTGTCCAGCTGACC -3'

Posted On

2014-01-15