Mutagenetix > Incidental Mutation

Incidental Mutation 'R1199:Pcsk1'

101237

Institutional Source

Beutler Lab

Gene Symbol

Pcsk1

Ensembl Gene

ENSMUSG00000021587

Gene Name

proprotein convertase subtilisin/kexin type 1

Synonyms

PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1

MMRRC Submission

039269-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1199 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75089826-75134861 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 75096413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022075]

AlphaFold

P63239

PDB Structure

Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000022075

SMART Domains

Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135349

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	T	9: 108,393,477	H80L	possibly damaging	Het
A1bg	A	T	15: 60,919,635		probably null	Het
Aco2	C	T	15: 81,895,193	S33L	probably damaging	Het
Agrn	T	A	4: 156,172,299	Y1283F	probably benign	Het
Akap6	T	C	12: 52,796,190	V107A	probably damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Btnl9	A	T	11: 49,180,747	V83E	probably damaging	Het
Camk2a	T	A	18: 60,952,324	C131*	probably null	Het
Ccdc14	C	T	16: 34,723,828	T852M	probably damaging	Het
Cntn4	T	C	6: 106,353,597		probably benign	Het
Cp	T	G	3: 19,977,152	S585R	probably damaging	Het
Cpt1b	G	A	15: 89,419,010	A614V	probably benign	Het
Crygn	T	C	5: 24,751,148	Y153C	probably damaging	Het
Dennd1a	A	T	2: 37,961,716	D53E	probably damaging	Het
Deptor	T	C	15: 55,252,010	C357R	probably benign	Het
Dnajc28	C	A	16: 91,618,642		probably benign	Het
Eml6	G	A	11: 29,755,044	A1500V	possibly damaging	Het
Fgd5	T	A	6: 91,986,978	L64Q	possibly damaging	Het
Fgfbp1	A	G	5: 43,979,597	Y118H	probably damaging	Het
Ftcd	G	A	10: 76,579,819	R135H	probably damaging	Het
Gm5174	A	T	10: 86,657,325		noncoding transcript	Het
Gpr37l1	A	T	1: 135,166,972	L178Q	probably damaging	Het
Gtf2ird1	A	G	5: 134,411,064	V104A	possibly damaging	Het
Irs1	T	A	1: 82,289,626	S290C	probably damaging	Het
Kel	C	T	6: 41,688,591	V532I	possibly damaging	Het
Kif1c	A	G	11: 70,708,601	E442G	possibly damaging	Het
Klhdc10	T	A	6: 30,449,494	V185D	probably damaging	Het
Lpp	C	T	16: 24,681,860	R141C	probably damaging	Het
Olfr1025-ps1	A	G	2: 85,918,035	I37V	probably benign	Het
Olfr68	A	T	7: 103,777,985	M120K	probably damaging	Het
Pcnx2	G	T	8: 125,887,314	P466H	possibly damaging	Het
Pkd2l2	T	C	18: 34,438,216		probably null	Het
Pomt1	A	G	2: 32,250,492	N454S	probably benign	Het
Samhd1	A	T	2: 157,109,461	I452N	probably damaging	Het
Sez6	A	G	11: 77,953,885	Q178R	probably benign	Het
Slc25a44	A	G	3: 88,420,986	V66A	probably damaging	Het
Slc46a2	T	C	4: 59,914,189	T245A	probably benign	Het
Slc4a4	G	A	5: 89,215,794		probably null	Het
Spata6	T	A	4: 111,799,145	C329S	possibly damaging	Het
Srrm2	A	T	17: 23,817,751		probably benign	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Svil	T	A	18: 5,059,217		probably benign	Het
Tenm3	G	T	8: 48,235,582	S2323R	probably damaging	Het
Tsc1	G	A	2: 28,665,626	R245Q	probably damaging	Het
Ttn	A	G	2: 76,908,756	V3813A	probably benign	Het
Ttn	G	A	2: 76,950,044	T1121M	possibly damaging	Het
Ush2a	G	A	1: 188,759,795	V3094I	probably benign	Het
Vcan	A	G	13: 89,679,794		probably null	Het
Vmn1r189	A	T	13: 22,102,658	L3Q	probably damaging	Het
Vmn1r60	A	C	7: 5,544,972	V43G	probably damaging	Het
Vmn2r110	A	G	17: 20,583,263	I350T	probably benign	Het
Vmn2r86	T	A	10: 130,448,574		probably benign	Het
Xrn1	A	G	9: 95,981,761		probably benign	Het
Zfp251	C	T	15: 76,854,236	R219Q	possibly damaging	Het

Other mutations in Pcsk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Pcsk1	APN	13	75132087	missense	probably benign
IGL01554:Pcsk1	APN	13	75132307	missense	probably benign
IGL01960:Pcsk1	APN	13	75093167	missense	possibly damaging	0.82
IGL02026:Pcsk1	APN	13	75112653	missense	probably benign	0.16
IGL02047:Pcsk1	APN	13	75097989	missense	probably benign	0.33
IGL02264:Pcsk1	APN	13	75105959	missense	probably damaging	1.00
IGL02441:Pcsk1	APN	13	75132163	missense	probably benign	0.16
IGL02795:Pcsk1	APN	13	75112620	missense	probably damaging	1.00
IGL02829:Pcsk1	APN	13	75126836	missense	probably damaging	1.00
IGL03116:Pcsk1	APN	13	75132216	missense	probably damaging	0.99
IGL03156:Pcsk1	APN	13	75131951	missense	probably benign
clipper	UTSW	13	75130070	missense	probably damaging	1.00
spareribs	UTSW	13	75115255	missense	possibly damaging	0.88
swivel	UTSW	13	75125984	missense	probably damaging	1.00
Tweeze	UTSW	13	75126839	missense	probably benign	0.00
PIT4453001:Pcsk1	UTSW	13	75112650	missense	probably damaging	1.00
R0771:Pcsk1	UTSW	13	75132162	missense	probably benign	0.31
R0894:Pcsk1	UTSW	13	75097977	missense	probably damaging	1.00
R1014:Pcsk1	UTSW	13	75132234	missense	probably damaging	1.00
R1035:Pcsk1	UTSW	13	75132119	missense	probably benign
R1517:Pcsk1	UTSW	13	75098047	nonsense	probably null
R1625:Pcsk1	UTSW	13	75126852	missense	probably benign	0.11
R1691:Pcsk1	UTSW	13	75132225	missense	possibly damaging	0.65
R1717:Pcsk1	UTSW	13	75110828	missense	probably damaging	0.99
R2168:Pcsk1	UTSW	13	75112534	intron	probably benign
R2252:Pcsk1	UTSW	13	75126726	missense	probably benign	0.00
R2400:Pcsk1	UTSW	13	75090126	missense	probably benign	0.00
R4110:Pcsk1	UTSW	13	75096369	missense	probably damaging	0.99
R4358:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4359:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4657:Pcsk1	UTSW	13	75132235	missense	probably damaging	1.00
R5195:Pcsk1	UTSW	13	75126855	missense	probably damaging	1.00
R5669:Pcsk1	UTSW	13	75130102	missense	probably benign	0.01
R5671:Pcsk1	UTSW	13	75097907	missense	possibly damaging	0.63
R5745:Pcsk1	UTSW	13	75131960	missense	probably benign	0.03
R6107:Pcsk1	UTSW	13	75127848	missense	probably benign	0.09
R6200:Pcsk1	UTSW	13	75115255	missense	possibly damaging	0.88
R6326:Pcsk1	UTSW	13	75132179	missense	possibly damaging	0.89
R6537:Pcsk1	UTSW	13	75132239	missense	probably damaging	1.00
R6541:Pcsk1	UTSW	13	75125984	missense	probably damaging	1.00
R6567:Pcsk1	UTSW	13	75130070	missense	probably damaging	1.00
R6723:Pcsk1	UTSW	13	75093069	splice site	probably null
R7258:Pcsk1	UTSW	13	75093186	missense	probably damaging	1.00
R7357:Pcsk1	UTSW	13	75125960	missense	probably damaging	0.96
R7487:Pcsk1	UTSW	13	75110883	missense	probably benign	0.01
R7519:Pcsk1	UTSW	13	75110865	missense	probably damaging	0.99
R7647:Pcsk1	UTSW	13	75132210	missense	possibly damaging	0.73
R7787:Pcsk1	UTSW	13	75132158	missense	possibly damaging	0.88
R7944:Pcsk1	UTSW	13	75132092	missense	probably benign
R7945:Pcsk1	UTSW	13	75132092	missense	probably benign
R7961:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8009:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8022:Pcsk1	UTSW	13	75099293	missense	possibly damaging	0.77
R8171:Pcsk1	UTSW	13	75090091	nonsense	probably null
R8489:Pcsk1	UTSW	13	75126002	missense	probably damaging	1.00
R9310:Pcsk1	UTSW	13	75090072	missense	probably benign
R9404:Pcsk1	UTSW	13	75132223	missense	probably benign	0.11
R9544:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9588:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9706:Pcsk1	UTSW	13	75099354	critical splice donor site	probably null
Z1176:Pcsk1	UTSW	13	75098042	missense	probably damaging	1.00
Z1177:Pcsk1	UTSW	13	75125864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGAGTTGGGGCCAGGCAAAA -3'
(R):5'- TGTCTTCTGCTGGGATCAGCAAGTA -3'

Sequencing Primer
(F):5'- TTTAGGGTGAAGGGTCTCAAAG -3'
(R):5'- ctctctttgccttcttgctttc -3'

Posted On

2014-01-15